Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU068681

Sigma-Aldrich

MISSION® esiRNA

targeting human PTK2B

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
193,00 €
50 μG
342,00 €

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
193,00 €
50 μG
342,00 €

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGGGGAGGTCTATGAAGGTGTCTACACAAATCACAAAGGGGAGAAAATCAATGTAGCTGTCAAGACCTGCAAGAAAGACTGCACTCTGGACAACAAGGAGAAGTTCATGAGCGAGGCAGTGATCATGAAGAACCTCGACCACCCGCACATCGTGAAGCTGATCGGCATCATTGAAGAGGAGCCCACCTGGATCATCATGGAATTGTATCCCTATGGGGAGCTGGGCCACTACCTGGAGCGGAACAAGAACTCCCTGAAGGTGCTCACCCTCGTGCTGTACTCACTGCAGATATGCAAAGCCATGGCCTACCTGGAGAGCATCAACTGCGTGCACAGGGACATTGCTGTCCGGAACATCCTGGTGGCCTCCCCTGAGTGTGTGAAGCTGGGGGACTTTGGTCTTTCCCGGTACA

Ensembl | nº de acceso humano

ENSG00000120899

Nº de acceso NCBI

NM_004103

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... PTK2B(2185) , PTK2B(2185)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
GWU
JUU
WDT
XZR
NXR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jialin Qian et al.
Oncology letters, 11(3), 1738-1744 (2016-03-22)
Lung cancer, specifically non-small cell lung cancer (NSCLC), is the leading cause of cancer-associated mortality in the world. In previous years, almost no significant advancements have been made towards the molecular characterization of NSCLC, which highlights the requirement for novel
Chien-Chung Yang et al.
International journal of molecular sciences, 21(1) (2020-01-08)
Neuroinflammation is a landmark of neuroinflammatory and neurodegenerative diseases. Matrix metalloproteinase (MMP)-9, one member of MMPs, has been shown to contribute to the pathology of these brain diseases. Several experimental models have demonstrated that lipopolysaccharide (LPS) exerts a pathological role
Chih-Chung Lin et al.
Frontiers in molecular neuroscience, 10, 387-387 (2017-12-07)
Neurodegenerative disorders and brain damage are initiated by excessive production of reactive oxygen species (ROS), which leads to tissue injury, cellular death and inflammation. In cellular anti-oxidant systems, heme oxygenase-1 (HO-1) is an oxidative-sensor protein induced by ROS generation or
Pradip Das et al.
Journal of immunology (Baltimore, Md. : 1950), 206(1), 181-192 (2020-12-06)
MCP-1-induced monocyte chemotaxis is a crucial event in inflammation and atherogenesis. Identifying the important signal transduction pathways that control monocyte chemotaxis can unravel potential targets for preventive therapies in inflammatory disease conditions. Previous studies have shown that the focal adhesion
Qiaoqiao Wan et al.
Scientific reports, 7(1), 9033-9033 (2017-08-24)
Focal adhesion kinase (FAK) and Src family kinases (SFK) are known to play critical roles in mechanotransduction and other crucial cell functions. Recent reports indicate that they reside in different microdomains of the plasma membrane. However, little is known about
Ver todos los artículos relacionados

Preguntas

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico