Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU063531

Sigma-Aldrich

MISSION® esiRNA

targeting human ACO1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
193,00 €
50 μG
342,00 €

193,00 €


Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad


Seleccione un Tamaño

Cambiar Vistas
20 μG
193,00 €
50 μG
342,00 €

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

193,00 €


Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACTTTGAGAGCTGCCTTGGAGCCAAGCAAGGATTTAAAGGATTCCAAGTTGCTCCTGAACATCATAATGACCATAAGACCTTTATCTATGATAACACTGAATTCACCCTTGCTCATGGTTCTGTGGTCATTGCTGCCATTACTAGCTGCACAAACACCAGTAATCCGTCTGTGATGTTAGGGGCAGGATTGTTAGCAAAGAAAGCTGTGGATGCTGGCCTGAACGTGATGCCTTACATCAAAACTAGCCTGTCTCCTGGGAGTGGCGTGGTCACCTACTACCTACAAGAAAGCGGAGTCATGCCTTATCTGTCTCAGCTTGGGTTTGACGTGGTGGGCTATGGCTGCATGACCTGCATTGGCAACAGTGGGCCTTTACCTGAACCTGTGGTAGAAGCCATCACACAGGGAGACCTT

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... ACO1(48) , ACO1(48)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jin Zhang et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(2), 2301-2311 (2020-01-08)
Iron is an essential element to all living organisms and plays a vital role in many cellular processes, such as DNA synthesis and energy production. The Mdm2 oncogene is an E3 ligase and known to promote tumor growth. However, the
Filomena Fiorito et al.
PloS one, 8(3), e58845-e58845 (2013-03-23)
Mammalian cells require iron to satisfy metabolic needs or to accomplish specialized functions, and DNA viruses, like bovine herpesvirus 1 (BHV-1), require an iron-replete host to efficiently replicate, so that iron bioavailability is an important component of viral virulence. Cellular
Laura Gonzalez-Sanchez et al.
Carcinogenesis, 41(8), 1113-1122 (2019-11-18)
Precursor T-cell lymphoblastic neoplasms are aggressive malignancies in need for more effective and specific therapeutic treatments. A significant fraction of these neoplasms harbor deletions on the locus 9p21, targeting the tumor suppressor CDKN2A but also deleting the aconitase 1 (ACO1)

Preguntas

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico