Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU063351

Sigma-Aldrich

MISSION® esiRNA

targeting human WHSC1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
193,00 €
50 μG
342,00 €

193,00 €


Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad


Seleccione un Tamaño

Cambiar Vistas
20 μG
193,00 €
50 μG
342,00 €

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

193,00 €


Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCCACCATACAAGCACATCAAGGTGAATAAGCCTTACGGGAAAGTCCAGATCTACACAGCGGATATTTCAGAAATCCCTAAGTGCAACTGCAAGCCCACAGATGAGAATCCTTGTGGCTTTGATTCGGAGTGTCTGAACAGGATGCTGATGTTTGAGTGCCACCCGCAGGTGTGTCCCGCGGGCGAGTTCTGCCAGAACCAGTGCTTCACCAAGCGCCAGTACCCAGAGACCAAGATCATCAAGACAGATGGCAAAGGGTGGGGCCTGGTCGCCAAGAGGGACATCAGAAAGGGAGAATTTGTTAACGAGTACGTTGGGGAGCTGATCGACGAGGAGGAGTGCATGGCGAGAATCAAGCACGCACACGAGAACGACATCACCCACTTCTACATGCTCACTATAGACAAGGACCGTATAATAGACGCTGGCCCCAAAGGAAACTACTCTCGATTTATGAATCACAGCTGCCAGC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Nicole M A White-Al Habeeb et al.
The Prostate, 76(16), 1507-1518 (2016-10-19)
This study explored the biological effects of metformin on prostate cancer (PCa) cells and determined molecular pathways and epigenetic regulators implicated in its mechanism of action. We performed mRNA expression profiling in 22Rv1 cells following 2.5 mM and 5 mM metformin treatment.
Liang-Yan Chen et al.
The Journal of pathology, 248(1), 103-115 (2019-01-23)
Liver metastasis is the main cause of death in patients with colorectal cancer (CRC). Here, we searched for CRC metastasis-associated circular RNA in a mouse model of liver metastasis of CRC by using RNA (transcriptome)-sequencing. We identified a novel and
Jin Woo Park et al.
Scientific reports, 5, 12485-12485 (2015-07-25)
Histone lysine methylation contributes to transcriptional regulation by serving as a platform for the recruitment of various cofactors. Intense studies have been conducted for elucidating the functional meaning of H3K79 methylation, and to date, the only known HMTase responsible for

Preguntas

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico