Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU062731

Sigma-Aldrich

MISSION® esiRNA

targeting human PHF8

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCTCGCCATCATTCACTGTGAGGGATGTTGAACACTATGTTGGTTCTGACAAAGAGATTGATGTGATTGATGTGACCCGCCAGGCTGACTGCAAGATGAAGCTTGGTGATTTTGTGAAATACTATTACAGCGGGAAGAGGGAGAAAGTCCTCAATGTCATTAGTTTGGAATTCTCTGATACCAGACTTTCTAACCTTGTGGAGACACCGAAGATTGTTCGAAAGCTGTCATGGGTCGAAAACTTGTGGCCAGAGGAATGTGTCTTTGAGAGACCCAATGTACAGAAGTACTGCCTCATGAGTGTGCGAGATAGCTATACAGACTTTCACATTGACTTTGGTGGCACCTCTGTCTGGTACCATGTACTCAAGGGTGAAAAGATCTTCTACCTGATCCGCCCAACAAATGCCAATCTGACTCTCTTTGAGTGCTGGAGCAGTTCCTCTAATCAGAATGAGATGTTCTTTGGGGACCA

Ensembl | nº de acceso humano

ENSG00000172943

Nº de acceso NCBI

NM_015107

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... PHF8(23133) , PHF8(23133)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
XZU
ZYU
OWU
BWR
QCS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ming-Zhi Cai et al.
Technology in cancer research & treatment, 19, 1533033820967472-1533033820967472 (2020-10-29)
Plant homeodomain finger protein 8 (PHF8) has been reported to participate in cancer development and metastasis of various types of tumors. However, little is known about the functional mechanism of PHF8 in gastric cancer (GC). This study aimed to explore
D Tong et al.
Oncogenesis, 5(12), e283-e283 (2016-12-20)
Recent studies provide strong evidence that the androgen receptor (AR) signaling pathway remains active in castration-resistant prostate cancer (CRPC). However, the underlying mechanisms are not well understood. In this study, we demonstrate that plant homeo domain finger protein 8 (PHF8
Peterson Kariuki Maina et al.
Oncotarget, 7(46), 75585-75602 (2016-10-01)
Epigenetic factors play critical roles in prostate cancer (PCa) development. However, how they contribute to neuroendocrine differentiation (NED) and castration-resistant PCa (CRPC) is not fully understood. Using bioinformatics and biochemical approaches to analyze cell-based models of NED and CRPC, we
Matthias S Leisegang et al.
FEBS letters, 593(5), 487-498 (2019-02-14)
Histone3-lysine9 (H3K9) residues not only control gene expression, but also contribute to RNA splicing. Here, the H3K9 histone demethylase PHF8 was investigated in endothelial cells for its involvement in alternative splicing. An angiogenic sprouting assay shows the importance of PHF8
Peterson Kariuki Maina et al.
Biochimica et biophysica acta. Gene regulatory mechanisms, 1860(9), 1002-1012 (2017-07-25)
Hypoxia through transcription factor HIF1α plays a critical role in cancer development. In prostate cancer, HIF1α interplays with androgen receptor (AR) to contribute to the progression of this disease to its lethal form-castration-resistant prostate cancer (CRPC). Hypoxia upregulates several epigenetic
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico