Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU059801

Sigma-Aldrich

MISSION® esiRNA

targeting human IGF1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGGATGCTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCAACAAGCCCACAGGGTATGGCTCCAGCAGTCGGAGGGCGCCTCAGACAGGCATCGTGGATGAGTGCTGCTTCCGGAGCTGTGATCTAAGGAGGCTGGAGATGTATTGCGCACCCCTCAAGCCTGCCAAGTCAGCTCGCTCTGTCCGTGCCCAGCGCCACACCGACATGCCCAAGACCCAGAAGGAAGTACATTTGAAGAACGCAAGTAGAGGGAGTGCAGGAAACAAGAACTACAGGATGTAGGAAGACCCTCCTGAGGAGTGAAGAGTGACATGCCACCGCAGGATCCTTTGCTCTGCACGAGTTACCTGTTAAACTTTGGAACACCTACCAAAAAATAAGTTTGATAACATTTAAAAGATGGGCGTTTCCCCCAATGAAATACACAAGTAAACATTCCAACATTGTCTTTAGGAGTGATTTGCACCTTGCAAAAATGGTCCTG

Ensembl | nº de acceso humano

ENSG00000017427

Nº de acceso NCBI

NM_000618

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... IGF1(3479) , IGF1(3479)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Binqiang Tian et al.
Journal of drug targeting, 25(7), 626-636 (2017-03-14)
We have previously reported that curcumin inhibits urothelial tumor development in a rat bladder carcinogenesis model. In this study, we report that curcumin inhibits urothelial tumor development by suppressing IGF2 and IGF2-mediated PI3K/AKT/mTOR signaling pathway. Curcumin inhibits IGF2 expression at
Saidan Ding et al.
Frontiers in cellular neuroscience, 11, 258-258 (2017-09-22)
Insulin-like growth factor I (IGF-I) has been positively correlated with cognitive ability. Cognitive decline in minimal hepatic encephalopathy (MHE) was shown to be induced by elevated intracranial dopamine (DA). The beneficial effect of IGF-I signaling in MHE remains unknown. In
Xiaojun Wang et al.
International immunopharmacology, 79, 106067-106067 (2019-12-28)
There is growing evidence of the ability of microRNAs (miRs) in rheumatoid arthritis (RA), thus our objective was to discuss the impact of miR-365 on the apoptosis and proliferation of synoviocytes in mice with RA by targeting IGF1 and mediating
Yan He et al.
Fitoterapia, 124, 200-205 (2017-11-21)
Insulin-like growth factor I (IGF-I) and binding protein 3 (IGFBP-3) play a role in the maintenance of gut mucosal barrier function. Nevertheless, IGF-I/IGFBP-3 and tight junction protein (TJP) expression in small intestinal mucosa are often impaired during endotoxemia. In this
P Cao et al.
Osteoarthritis and cartilage, 27(2), 336-346 (2018-12-07)
This study aimed to explore potential microRNAs (miRNAs), which participate in the pathological process of condylar hyperplasia (CH) through targeting specific proliferation- and apoptosis- related genes of chondrocytes. Insulin-like growth factor 1 (IGF1), IGF1 receptor (IGF1R) and B-cell CLL/lymphoma 2
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico