Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU056571

Sigma-Aldrich

MISSION® esiRNA

targeting human CCNA2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
193,00 €
50 μG
342,00 €

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
193,00 €
50 μG
342,00 €

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCTATCCTCGTGGACTGGTTAGTTGAAGTAGGAGAAGAATATAAACTACAGAATGAGACCCTGCATTTGGCTGTGAACTACATTGATAGGTTCCTGTCTTCCATGTCAGTGCTGAGAGGAAAACTTCAGCTTGTGGGCACTGCTGCTATGCTGTTAGCCTCAAAGTTTGAAGAAATATACCCCCCAGAAGTAGCAGAGTTTGTGTACATTACAGATGATACCTACACCAAGAAACAAGTTCTGAGAATGGAGCATCTAGTTTTGAAAGTCCTTACTTTTGACTTAGCTGCTCCAACAGTAAATCAGTTTCTTACCCAATACTTTCTGCATCAGCAGCCTGCAAACTGCAAAGTTGAAAGTTTAGCAATGTTTTTGGGAGAATTAAGTTTGATAGATGCTGACCCATACCTCAAGTATTTGCCATCAGTTATTGCTGGAGCTGCCTTT

Ensembl | nº de acceso humano

ENSG00000145386

Nº de acceso NCBI

NM_001237

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CCNA2(890) , CCNA2(890)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
IYT
RWS
PQR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Fei Guo et al.
International journal of oncology, 57(1), 264-276 (2020-05-08)
Ovarian cancer is the most lethal gynecological tumor, and the 5‑year survival rate is only ~40%. The poor survival rate is due to cancer diagnosis at an advanced stage, when the tumor has metastasized. A better understanding of the molecular pathogenesis
Patrick E Gygli et al.
Aging, 8(7), 1540-1570 (2016-07-19)
Various stem cell niches of the brain have differential requirements for Cyclin A2. Cyclin A2 loss results in marked cerebellar dysmorphia, whereas forebrain growth is retarded during early embryonic development yet achieves normal size at birth. To understand the differential
Hemabindu Chintala et al.
Development (Cambridge, England), 142(13), 2364-2374 (2015-05-24)
Physiological angiogenesis depends on the highly coordinated actions of multiple angiogenic regulators. CCN1 is a secreted cysteine-rich and integrin-binding matricellular protein required for proper cardiovascular development. However, our understanding of the cellular origins and activities of this molecule is incomplete.
Yu Di et al.
Drug design, development and therapy, 9, 2463-2473 (2015-05-23)
CCN1 (also called Cyr 61) is an extracellular matrix signaling molecule that has been implicated in neovascularization through its interactions with several endothelial integrin receptors. The roles of vascular endothelial growth factor (VEGF) in angiogenesis are well described. The aim

Preguntas

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico