Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU053851

Sigma-Aldrich

MISSION® esiRNA

targeting human PROX1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
193,00 €
50 μG
342,00 €

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
193,00 €
50 μG
342,00 €

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGCTCTCCTTGTCGCTCATAAAGTCCGAGTGCGGCGATCTTCAAGATATGTCTGAAATATCACCTTATTCGGGAAACTCTATGGAGGAAGGATTGTCACCCAATCACTTGAAAAAAGCAAAGCTCATGTTTTTTTATACCCGTTATCCCAGCTCCAATATGCTGAAGACCTACTTCTCCGACGTAAAGTTCAACAGATGCATTACCTCTCAGCTCATCAAGTGGTTTAGCAATTTCCGTGAGTTTTACTACATTCAGATGGAGAAGTACGCACGTCAAGCCATCAACGATGGGGTCACCAGTACTGAAGAGCTGTCTATAACCAGAGACTGTGAGCTGTACAGGGCTCTGAACATGCACTACAATAAAGCAAATGACTTTGAGGTTCCAGAGAGATTCCTGGAAGTTGCTCAGATCACATTACGGGAGTTTTTCAATGCCATTATCGCA

Ensembl | nº de acceso humano

ENSG00000117707

Nº de acceso NCBI

NM_002763

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... PROX1(5629) , PROX1(5629)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
FSU
GNU
TJU
EIU
FGU

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Toshihiko Goto et al.
FEBS letters, 591(4), 624-635 (2017-01-28)
Previous reports have revealed that Prospero-related homeobox 1 (Prox1) is required for the migration and differentiation of hepatoblasts during embryonic liver formation. However, the role of Prox1 in adults remains to be elucidated. We created liver-specific Prox1 knockout mice to
Tomonori Sasahira et al.
PloS one, 9(3), e92534-e92534 (2014-03-22)
Prospero homeobox 1 (Prox1) and forkhead box (FOX) C2 regulate angiogenesis and/or lymphangiogenesis. However, the detailed role and function of Prox1 and FOXC2 in cancer remains controversial. In the present study, we examined the expression of Prox1 and FOXC2 proteins
Chang Rae Rho et al.
Investigative ophthalmology & visual science, 56(10), 5871-5879 (2015-09-09)
Prospero homeobox 1 (Prox1) siRNA is a small interfering RNA that is designed to specifically bind Prox1 mRNA. We determined whether Prox1 siRNA inhibits lymphangiogenesis and hemangiogenesis after acute corneal inflammation. Three Prox1 siRNAs were synthesized and investigated for their
Kang-Jin Park et al.
Gastric cancer : official journal of the International Gastric Cancer Association and the Japanese Gastric Cancer Association, 20(1), 104-115 (2016-01-14)
Prospero homeobox 1 (PROX1) functions as a tumor suppressor gene or an oncogene in various cancer types. However, the distinct function of PROX1 in gastric cancer is unclear. We determined whether PROX1 affected the oncogenic behavior of gastric cancer cells
René Hägerling et al.
The EMBO journal, 32(5), 629-644 (2013-01-10)
During mammalian development, a subpopulation of endothelial cells in the cardinal vein (CV) expresses lymphatic-specific genes and subsequently develops into the first lymphatic structures, collectively termed as lymph sacs. Budding, sprouting and ballooning of lymphatic endothelial cells (LECs) have been
Ver todos los artículos relacionados

Preguntas

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico