Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU053361

Sigma-Aldrich

MISSION® esiRNA

targeting human ADORA2B

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
193,00 €
50 μG
342,00 €

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
193,00 €
50 μG
342,00 €

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AATGAAAGCTGCTGCCTTGTGAAGTGTCTCTTTGAGAATGTGGTCCCCATGAGCTACATGGTATATTTCAATTTCTTTGGGTGTGTTCTGCCCCCACTGCTTATAATGCTGGTGATCTACATTAAGATCTTCCTGGTGGCCTGCAGGCAGCTTCAGCGCACTGAGCTGATGGACCACTCGAGGACCACCCTCCAGCGGGAGATCCATGCAGCCAAGTCACTGGCCATGATTGTGGGGATTTTTGCCCTGTGCTGGTTACCTGTGCATGCTGTTAACTGTGTCACTCTTTTCCAGCCAGCTCAGGGTAAAAATAAGCCCAAGTGGGCAATGAATATGGCCATTCTTCTGTCACATGCCAATTCAGTTGTCAATCCCATTGTCTATGCTTACCGGAACCGAG

Ensembl | nº de acceso humano

ENSG00000170425

Nº de acceso NCBI

NM_000676

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... ADORA2B(136) , ADORA2B(136)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
JXU
QCS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Alisha Wehdnesday Bernardo Reyes et al.
Veterinary microbiology, 242, 108586-108586 (2020-03-04)
Brucella as a stealthy intracellular pathogen avoids activation of innate immune response. Here we investigated the contribution of an adenosine receptor, Adora2b, during Brucella infection in professional phagocyte RAW 264.7 cells and in a murine model. Adora2b-deficient cells showed attenuated
Max Wilkat et al.
International journal of cancer, 147(1), 202-217 (2019-12-18)
Adenosine is a signaling molecule that exerts dual effects on tumor growth: while it inhibits immune cell function and thereby prevents surveillance by the immune system, it influences tumorigenesis directly via activation of adenosine receptors on tumor cells at the
J S Long et al.
Oncogene, 34(40), 5152-5162 (2015-02-11)
Tumour cells often acquire the ability to escape cell death, a key event leading to the development of cancer. In almost half of all human cancers, the capability to induce cell death is reduced by the mutation and inactivation of

Preguntas

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico