Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU052901

Sigma-Aldrich

MISSION® esiRNA

targeting human GDF15

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GAGGTGCAAGTGACCATGTGCATCGGCGCGTGCCCGAGCCAGTTCCGGGCGGCAAACATGCACGCGCAGATCAAGACGAGCCTGCACCGCCTGAAGCCCGACACGGTGCCAGCGCCCTGCTGCGTGCCCGCCAGCTACAATCCCATGGTGCTCATTCAAAAGACCGACACCGGGGTGTCGCTCCAGACCTATGATGACTTGTTAGCCAAAGACTGCCACTGCATATGAGCAGTCCTGGTCCTTCCACTGTGCACCTGCGCGGAGGACGCGACCTCAGTTGTCCTGCCCTGTGGAATGGGCTCAAGGTTCCTGAGACACCCGATTCCTGCCCAAACAGCTGTATTTATATAAGTCTGTTATTTATTATTAATTTATTGGGGTGACCTTCTTGGGGACTCGG

Ensembl | nº de acceso humano

ENSG00000130513

Nº de acceso NCBI

NM_004864

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... GDF15(9518) , GDF15(9518)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
XBU
DXS
HQS
UMS
FHS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yixin Zhang et al.
Oncotarget, 8(22), 36531-36544 (2017-04-08)
Ischemia reperfusion (I/R) injury which inevitably occurs during heart transplantation is the major factor leading to organ failure and graft rejection. In order to develop new therapies to prevent I/R injury, we used both a murine heart transplantation model with
Yanwei Lu et al.
Cell death & disease, 8(9), e3036-e3036 (2017-09-08)
CDP138, a CDK5 binding partner, regulates cell proliferation and migration. However, the mechanisms by which CDP138 functions in these processes remain unclear. In this study, we show that CDP138 is frequently overexpressed and that high levels of CDP138 are correlated
Maria Louca et al.
Cancers, 11(8) (2019-08-16)
Glioblastoma multiforme (GBM) is the most aggressive type of brain tumor due to its invasive phenotype. Ras suppressor 1 (RSU-1) is a cell-extracellular matrix adhesion protein and we recently found that it promotes cell invasion in aggressive cells and inhibits
Wenchu Wang et al.
Oncogene, 38(23), 4540-4559 (2019-02-14)
Bone is the most frequent site of prostate cancer (PCa) metastasis; however, little is known about the role of the most common cell in bone, the osteocyte (OCy), in cancer biology. In this study we explored the crosstalk between PCa
Hongtu Zheng et al.
BioMed research international, 2020, 5958272-5958272 (2020-02-23)
Hypoxia plays an essential role in orchestrating Epithelial-mesenchymal transition and promoting metastasis of colorectal cancer. However, the underlying mechanisms are still not well elucidated. Here, we present that hypoxic exposure causes endoplasmic reticulum stress and activates the unfolded protein response
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico