Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU052811

Sigma-Aldrich

MISSION® esiRNA

targeting human BMPER

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
193,00 €
50 μG
342,00 €

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
193,00 €
50 μG
342,00 €

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCTGGATGGCTACCTCTTGAAAGTGACCACCAAAGCAGGTTTGGAAATATCTTGGGATGGAGACAGTTTTGTAGAAGTCATGGCTGCGCCGCATCTCAAGGGCAAGCTCTGTGGTCTTTGTGGCAACTACAATGGACATAAACGTGATGACTTAATTGGTGGAGATGGAAACTTCAAGTTTGATGTGGATGACTTTGCTGAATCTTGGAGGGTGGAGTCCAATGAGTTCTGCAACAGACCTCAGAGAAAGCCAGTGCCTGAACTGTGTCAAGGGACAGTCAAGGTAAAGCTCCGGGCCCATCGAGAATGCCAAAAGCTCAAATCCTGGGAGTTTCAGACCTGCCACTCGACTGTGGACTACGCCACTTTCTACCGGTCCTGTGTGACAGACATGTGTGAATGTCCAGTCCATAAAAACTGTTATTGCGAGTCATTTTTGGCATATACCCGG

Ensembl | nº de acceso humano

ENSG00000164619

Nº de acceso NCBI

NM_133468

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... BMPER(168667) , BMPER(168667)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yong Xi et al.
BioMed research international, 2020, 3607436-3607436 (2020-04-21)
BMPER has been reported to be associated with the biological behavior of a few malignant tumors, but the mechanism is still unclear. We aimed to detect BMPER expression in ovarian epithelial tumor tissues and its effects on their biological behaviors
Thomas Helbing et al.
Inflammation, 40(2), 442-453 (2016-12-21)
The endothelium serves as a selective barrier and controls the exchange of nutrients, hormones, and leukocytes between blood and tissues. Molecular mechanisms contributing to the pathogenesis of endothelial barrier dysfunction remain incompletely understood. Accumulating evidence implicates bone morphogenetic protein (BMP)-modulator

Preguntas

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico