Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU051661

Sigma-Aldrich

MISSION® esiRNA

targeting human ITGB3, RP11-290H9.2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
193,00 €
50 μG
342,00 €

193,00 €


Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad


Seleccione un Tamaño

Cambiar Vistas
20 μG
193,00 €
50 μG
342,00 €

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

193,00 €


Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CAGGCATTGTCCAGCCTAATGACGGGCAGTGTCATGTTGGTAGTGACAATCATTACTCTGCCTCCACTACCATGGATTATCCCTCTTTGGGGCTGATGACTGAGAAGCTATCCCAGAAAAACATCAATTTGATCTTTGCAGTGACTGAAAATGTAGTCAATCTCTATCAGAACTATAGTGAGCTCATCCCAGGGACCACAGTTGGGGTTCTGTCCATGGATTCCAGCAATGTCCTCCAGCTCATTGTTGATGCTTATGGGAAAATCCGTTCTAAAGTAGAGCTGGAAGTGCGTGACCTCCCTGAAGAGTTGTCTCTATCCTTCAATGCCACCTGCCTCAACAATGAGGTCATCCCTGGCCTCAAGTCTTGTATGGGACTCAAGATTGGAGACACGGTGAGC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jing Wu et al.
Journal of cellular physiology, 235(11), 8679-8690 (2020-04-24)
Tumor-associated microglial cells promote glioma growth, invasion, and chemoresistance by releasing inflammatory factors. Milk fat globule EGF factor 8 protein (MFG-E8), a secreted glycoprotein, is closely related to tissue homeostasis and anti-inflammation. In the present study, we investigated the role
Hanan S Elsarraj et al.
NPJ breast cancer, 6, 12-12 (2020-05-01)
The molecular processes by which some human ductal carcinoma in situ (DCIS) lesions advance to the more aggressive form, while others remain indolent, are largely unknown. Experiments utilizing a patient-derived (PDX) DCIS Mouse INtraDuctal (MIND) animal model combined with ChIP-exo
Francesco Baschieri et al.
Nature communications, 9(1), 3825-3825 (2018-09-22)
It is generally assumed that cells interrogate the mechanical properties of their environment by pushing and pulling on the extracellular matrix (ECM). For instance, acto-myosin-dependent contraction forces exerted at focal adhesions (FAs) allow the cell to actively probe substrate elasticity.

Preguntas

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico