Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU049051

Sigma-Aldrich

MISSION® esiRNA

targeting human XRN2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
193,00 €
50 μG
342,00 €

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
193,00 €
50 μG
342,00 €

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGATGCTAGTGCTCCTGGTGAAGGAGAACATAAAATCATGGATTACATTAGAAGGCAAAGAGCCCAGCCTAACCATGACCCAAATACTCATCATTGTTTATGTGGAGCAGATGCTGATCTCATTATGCTTGGCCTTGCCACACATGAACCGAACTTTACCATTATTAGAGAAGAATTCAAACCAAACAAGCCCAAACCATGTGGTCTTTGTAATCAGTTTGGACATGAGGTCAAAGATTGTGAAGGTTTGCCAAGAGAAAAGAAGGGAAAGCATGATGAACTTGCCGATAGTCTTCCTTGTGCAGAAGGAGAGTTTATCTTCCTTCGGCTTAATGTTCTTCGTGAGTATTTGGAAAGAGAACTCACAATGGCCAGCCTACCATTCACATTTGATGTTGAGAGGAGCATTGATGACTGGGTTTTCATGTGCTTCTTTGTGGGAAATGACTTCCTCC

Ensembl | nº de acceso humano

ENSG00000088930

Nº de acceso NCBI

NM_012255

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... XRN2(22803) , XRN2(22803)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
NOU
BRT
HRX
HXR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Praveen L Patidar et al.
Scientific reports, 10(1), 14253-14253 (2020-08-30)
Persistent R-loops (RNA-DNA hybrids with a displaced single-stranded DNA) create DNA damage and lead to genomic instability. The 5'-3'-exoribonuclease 2 (XRN2) degrades RNA to resolve R-loops and promotes transcription termination. Previously, XRN2 was implicated in DNA double strand break (DSB)
Rodney P Kincaid et al.
Proceedings of the National Academy of Sciences of the United States of America, 115(32), 8197-8202 (2018-07-25)
Seventy percent of people infected with hepatitis C virus (HCV) will suffer chronic infection, putting them at risk for liver disease, including hepatocellular carcinoma. The full range of mechanisms that render some people more susceptible to chronic infection and liver
Jong-Sun Lee et al.
Molecular cell, 77(5), 1044-1054 (2020-01-12)
Antisense oligonucleotides (ASOs) that trigger RNase-H-mediated cleavage are commonly used to knock down transcripts for experimental or therapeutic purposes. In particular, ASOs are frequently used to functionally interrogate long noncoding RNAs (lncRNAs) and discriminate lncRNA loci that produce functional RNAs
Shin-Ichiro Hori et al.
Biochemical and biophysical research communications, 464(2), 506-511 (2015-07-15)
Antisense oligonucleotides (ASOs) can suppress the expression of a target gene by cleaving pre-mRNA and/or mature mRNA via RNase H1. Following the initial endonucleolytic cleavage by RNase H1, the target RNAs are degraded by a mechanism that is poorly understood.
Oussama Meziane et al.
Scientific reports, 5, 16688-16688 (2015-11-21)
The decapping scavenger enzyme DcpS is known for its role in hydrolyzing the cap structure following mRNA degradation. Recently, we discovered a new function in miRNA degradation activation for the ortholog of DcpS in C. elegans. Here we show that

Preguntas

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico