Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU046101

Sigma-Aldrich

MISSION® esiRNA

targeting human KDELR2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
193,00 €
50 μG
342,00 €

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
193,00 €
50 μG
342,00 €

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TACCTTGCCTGCTCCTATGCCACAGTGTACCTGATCTACCTGAAATTTAAGGCAACCTACGATGGAAATCATGATACCTTCCGAGTGGAGTTTCTGGTGGTCCCTGTGGGAGGCCTCTCATTTTTAGTTAATCACGATTTCTCTCCTCTTGAGATCCTCTGGACCTTCTCCATCTACCTGGAGTCCGTGGCTATCCTTCCGCAGCTATTTATGATCAGCAAGACTGGGGAGGCCGAGACCATCACCACCCACTACCTGTTCTTCCTGGGCCTCTATCGTGCTTTGTATCTTGTCAACTGGATCTGGCGCTTCTACTTTGAGGGCTTCTTTGACCTCATTGCTGTGGTGGCCGGCGTAGTCCAGACCATCCTATACTGTGACTTCTTCTACTTGTACATTACAAAAGTACTCAAGGGAAAGAAGCTCAGTTTGCCAGCATAAGTGCCAAAGACCATCACC

Ensembl | nº de acceso humano

ENSG00000136240

Nº de acceso NCBI

NM_006854

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... KDELR2(11014) , KDELR2(11014)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
IDU

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Rakhee Bajaj et al.
Oncogene, 39(37), 5979-5994 (2020-08-06)
Non-small cell lung cancer (NSCLC) is the deadliest form of cancer worldwide, due in part to its proclivity to metastasize. Identifying novel drivers of invasion and metastasis holds therapeutic potential for the disease. We conducted a gain-of-function invasion screen, which
Hui Mao et al.
Pathology, research and practice, 216(7), 152996-152996 (2020-06-15)
The KDEL receptor is a seven-transmembrane-domain protein, which plays a key role in ER quality control and in the ER stress response, KDELR2 involved in regulation of cellular functions, including cell proliferation, survival, promotes glioblastoma tumorigenesis. The aim of this

Preguntas

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico