Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU030431

Sigma-Aldrich

MISSION® esiRNA

targeting human SNAI1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTTACCTTCCAGCAGCCCTACGACCAGGCCCACCTGCTGGCAGCCATCCCACCTCCGGAGATCCTCAACCCCACCGCCTCGCTGCCAATGCTCATCTGGGACTCTGTCCTGGCGCCCCAAGCCCAGCCAATTGCCTGGGCCTCCCTTCGGCTCCAGGAGAGTCCCAGGGTGGCAGAGCTGACCTCCCTGTCAGATGAGGACAGTGGGAAAGGCTCCCAGCCCCCCAGCCCACCCTCACCGGCTCCTTCGTCCTTCTCCTCTACTTCAGTCTCTTCCTTGGAGGCCGAGGCCTATGCTGCCTTCCCAGGCTTGGGCCAAGTGCCCAAGCAGCTGGCCCAGCTCTCTGAGGCCAAGGATCTCCAGGCTCGAAAGGCCTTCAACTGCAAATACTGCAACAAGGAATACCTCAGCCTGG

Ensembl | nº de acceso humano

ENSG00000124216

Nº de acceso NCBI

NM_005985

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... SNAI1(6615) , SNAI1(6615)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
CIU
VFT
SPS
HOS
QFS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yu-Yi Liu et al.
Scientific reports, 7(1), 2461-2461 (2017-05-28)
We previously performed long non-coding RNA (lncRNA) expression microarray analyses to identify novel indicators for gastric cancer (GC) metastasis and prognosis in which we identified lncRNA XLOC_010235 (XLOC) as a candidate RNA. However, XLOC_010235 molecular mechanism of action remains unclear.
Dong Yeon Kim et al.
Oncotarget, 8(63), 106190-106205 (2018-01-02)
Renal tubulointerstitial fibrosis is an important event in the pathogenesis of diabetic nephropathy. Under pathologic conditions, renal tubular epithelial cells undergo transition characterized by loss of cell-cell adhesion and increased cell migration. This study investigated that eucalyptol inhibited tubular epithelial
Elsa M Reyes-Reyes et al.
Oncotarget, 8(61), 103828-103842 (2017-12-22)
Although several lines of evidence have established the central role of epithelial-to-mesenchymal-transition (EMT) in malignant progression of non-small cell lung cancers (NSCLCs), the molecular events connecting EMT to malignancy remain poorly understood. This study presents evidence that Long Interspersed Nuclear
Hong Li et al.
Theranostics, 9(7), 1909-1922 (2019-05-01)
Rationale: Glioblastoma (GBM) is the most common and aggressive brain tumor, characterized by its propensity to invade the surrounding brain parenchyma. The effect of extracellular high-mobility group box 1 (HMGB1) protein on glioblastoma (GBM) progression is still controversial. p62 is
Atsuhiro Kanda et al.
Scientific reports, 9(1), 673-673 (2019-01-27)
The epithelial-mesenchymal transition (EMT) is a key process in fibrogenic diseases where transdifferentiated myofibroblasts produce excessive amounts of extracellular matrix, resulting in organ dysfunction. Idiopathic epiretinal membrane (iERM) is a vision-threatening disorder characterized by fibrocellular proliferation and contraction on the
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico