Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU030001

Sigma-Aldrich

MISSION® esiRNA

targeting human DAB1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
193,00 €
50 μG
342,00 €

193,00 €


Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad


Seleccione un Tamaño

Cambiar Vistas
20 μG
193,00 €
50 μG
342,00 €

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

193,00 €


Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCGGGATTGATGAAGTTTCCGCAGCTCGGGGAGACAAGTTATGTCAAGATTCCATGATGAAACTCAAGGGCGTTGTTGCTGGCGCTCGTTCCAAAGGAGAACACAAACAGAAAATCTTTTTAACCATCTCCTTTGGAGGAATCAAAATCTTTGATGAGAAGACAGGGGCCCTTCAGCATCATCATGCTGTTCATGAAATATCCTACATTGCAAAGGACATTACAGATCACCGGGCCTTTGGATATGTTTGTGGGAAGGAAGGGAATCACAGATTTGTGGCCATAAAAACAGCCCAGGCGGCTGAACCTGTTATTCTGGACTTGAGAGATCTCTTTCAACTCATTTATGAATTGAAGCAAAGAGAAGAATTAGAAAAAAAGGCACAAAAGGATAAGCAGTGTGAACAAGCTGTGTACCAGACAATATTGGAAGAGGATGTTGAAGATCCTGTGTACCAGTACATTGTGTTTGAGGCTGGACAC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Bon-Hyeock Koo et al.
Experimental & molecular medicine, 51(6), 60-60 (2019-06-04)
Although arginase II (ArgII) is abundant in mitochondria, Ca2+-accumulating organelles, the relationship between ArgII activity and Ca2+ translocation into mitochondria and the regulation of cytosolic Ca2+ signaling are completely unknown. We investigated the effects of ArgII activity on mitochondrial Ca2+
Isabelle Tancioni et al.
Molecular cancer therapeutics, 13(8), 2050-2061 (2014-06-06)
Ovarian cancer ascites fluid contains matrix proteins that can impact tumor growth via integrin receptor binding. In human ovarian tumor tissue arrays, we find that activation of the cytoplasmic focal adhesion (FAK) tyrosine kinase parallels increased tumor stage, β5 integrin
Julia Lindqvist et al.
Molecular biology of the cell, 26(11), 1971-1984 (2015-04-09)
Contrary to cell cycle-associated cyclin-dependent kinases, CDK5 is best known for its regulation of signaling processes in differentiated cells and its destructive activation in Alzheimer's disease. Recently, CDK5 has been implicated in a number of different cancers, but how it

Preguntas

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico