Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU023131

Sigma-Aldrich

MISSION® esiRNA

targeting human LAMC2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
193,00 €
50 μG
342,00 €

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
193,00 €
50 μG
342,00 €

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTCAGCTGTCCAGCTTGCTATAATCAAGTGAAGATTCAGATGGATCAGTTTATGCAGCAGCTTCAGAGAATGGAGGCCCTGATTTCAAAGGCTCAGGGTGGTGATGGAGTAGTACCTGATACAGAGCTGGAAGGCAGGATGCAGCAGGCTGAGCAGGCCCTTCAGGACATTCTGAGAGATGCCCAGATTTCAGAAGGTGCTAGCAGATCCCTTGGTCTCCAGTTGGCCAAGGTGAGGAGCCAAGAGAACAGCTACCAGAGCCGCCTGGATGACCTCAAGATGACTGTGGAAAGAGTTCGGGCTCTGGGAAGTCAGTACCAGAACCGAGTTCGGGATACTCACAGGCTCATCACTCAGATGCAGCTGAGCCTGGCAGAAAGTGAAGCTTCCTTGGGAAACACTAACATTCCTGCCTCAGACCACTACGTGGGGCCAAATGGCTTTAAAAGTCTGGCTCAGGAGGCCACAAGATTAGCAGAAAGCCACGTTGAGTCA

Ensembl | nº de acceso humano

ENSG00000058085

Nº de acceso NCBI

NM_005562

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... LAMC2(3918) , LAMC2(3918)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QAS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Qiang-Hua Zhou et al.
Cancer management and research, 10, 2983-2995 (2018-09-15)
Molecular biomarkers, especially serologic factors, have been widely applied in cancer diagnosis and patient follow-up. However, there are few valuable prognostic factors in penile squamous cell carcinoma (PSCC). Here, the authors investigated whether laminin gamma 2 (LAMC2) expression, especially serum
Yao-Fei Pei et al.
The American journal of pathology, 189(8), 1637-1653 (2019-07-28)
Cholangiocarcinoma (CCA) is a malignant cancer that is associated with high mortality rates. The relationship between laminin γ 2 chain gene (LAMC2) and epidermal growth factor receptor (EGFR) has been previously documented in gastric cancer and oral squamous cell carcinoma.
Yan Liang et al.
Cell death and differentiation, 25(11), 1980-1995 (2018-03-08)
Esophageal squamous cell carcinoma (ESCC) is the main subtype of esophageal cancer. Long noncoding RNAs (lncRNAs) are thought to play a critical role in cancer development. Recently, lncRNA CASC9 was shown to be dysregulated in many cancer types, but the
Manoj Garg et al.
Scientific reports, 7(1), 9749-9749 (2017-08-31)
Anaplastic thyroid carcinoma (ATC) is one of the most lethal malignancies having no effective treatment. Exportin-1 (XPO1) is the key mediator of nuclear export of many tumor suppressor proteins and is overexpressed in human cancers. In this study, we examined
D O Velez et al.
Nature communications, 8(1), 1651-1651 (2017-11-23)
The topographical organization of collagen within the tumor microenvironment has been implicated in modulating cancer cell migration and independently predicts progression to metastasis. Here, we show that collagen matrices with small pores and short fibers, but not Matrigel, trigger a
Ver todos los artículos relacionados

Preguntas

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico