Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

Ver Toda la documentación

EHU018911

Sigma-Aldrich

MISSION® esiRNA

targeting human ITK

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
193,00 €
50 μG
342,00 €

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
193,00 €
50 μG
342,00 €

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCCTCCTGGAAGAACAGCTCATCAAGAAATCCCAACAAAAGAGAAGAACTTCTCCCTCGAACTTTAAAGTCCGCTTCTTTGTGTTAACCAAAGCCAGCCTGGCATACTTTGAAGATCGTCATGGGAAGAAGCGCACGCTGAAGGGGTCCATTGAGCTCTCCCGAATCAAATGTGTTGAGATTGTGAAAAGTGACATCAGCATCCCATGCCACTATAAATACCCGTTTCAGGTGGTGCATGACAACTACCTCCTATATGTGTTTGCTCCAGATCGTGAGAGCCGGCAGCGCTGGGTGCTGGCCCTTAAAGAAGAAACGAGGAATAATAACAGTTTGGTGCCTAAATATCATCCTAATTTCTGGATGGATGGGAAGTGGAGGTGCTGTTCTCAGCTGGAGAAGCTTGCAACAGGCTGTGCCCAATATGATCCAACCAAGAATGCTTCAAAGAAGCCTCTTCCTCCTACTCCTGAAGACAACAGGCGACCACTTTGGGAACCTGAA

Ensembl | nº de acceso humano

ENSG00000113263

Nº de acceso NCBI

NM_005546

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... ITK(3702) , ITK(3702)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
NRR
RPR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hongyang Li et al.
Journal of dermatological science, 97(3), 208-215 (2020-03-14)
The treatment of Cutaneous T-cell lymphoma (CTCL) met huge challenges because of the heterogeneity and the scarcity of targeted drugs. ECPIRM derived from isotretinoin exhibited strong anti-proliferation effects in Hut78 and MJ cells rather than Myla cells. However, there was
Yonglian Sun et al.
Science signaling, 8(405), ra122-ra122 (2015-12-03)
Interleukin-2 (IL-2)-inducible T cell kinase (ITK) mediates T cell receptor (TCR) signaling primarily to stimulate the production of cytokines, such as IL-4, IL-5, and IL-13, from T helper 2 (TH2) cells. Compared to wild-type mice, ITK knockout mice are resistant

Preguntas

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico