Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU018231

Sigma-Aldrich

MISSION® esiRNA

targeting human SP1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCGCTCCCAACTTACAGAACCAGCAAGTTCTGACAGGACTACCTGGAGTGATGCCTAATATTCAGTATCAAGTAATCCCACAGTTCCAGACCGTTGATGGGCAACAGCTGCAGTTTGCTGCCACTGGGGCCCAAGTGCAGCAGGATGGTTCTGGTCAAATACAGATCATACCAGGTGCAAACCAACAGATTATCACAAATCGAGGAAGTGGAGGCAACATCATTGCTGCTATGCCAAACCTACTCCAGCAGGCTGTCCCCCTCCAAGGCCTGGCTAATAATGTACTCTCAGGACAGACTCAGTATGTGACCAATGTACCAGTGGCCCTGAATGGGAACATCACCTTGCTACCTGTCAACAGCGTTTCTGCAGCTACCTTGACTCCCAGCTCTCAGGCAGTCACGATCAGCAGCTCTGGGTCCCAGGAGAGTGGCTCACAGCCTGTCACCTCAGGGACTACCATCAGTTCTGCCAGCTTGGTATCATCACAAGCCAGTTCCAGCT

Ensembl | nº de acceso humano

ENSG00000185591

Nº de acceso NCBI

NM_138473

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... SP1(6667) , SP1(6667)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Lili Lv et al.
Oncology research, 26(5), 775-783 (2017-12-16)
Cervical cancer is the third most commonly diagnosed malignancy and the fourth leading cause of cancer-related deaths in women worldwide. MicroRNA-296 (miR-296) is aberrantly expressed in a variety of human cancer types. However, the expression levels, biological roles, and underlying
Jie Qi et al.
Journal of diabetes research, 2020, 2308520-2308520 (2020-03-19)
Cyclooxygenase 2 (COX2) and inducible nitric oxide synthase (iNOS) overexpression results in endothelial apoptosis, thus mediating vascular endothelial injury in hyperglycaemia. E26 transformation-specific sequence transcription factor-1 (ESE-1), which belongs to the E26 transformation-specific family of transcription factors, has been demonstrated
Im-Kyung Kim et al.
Scientific reports, 9(1), 5933-5933 (2019-04-13)
Specific protein 1 (SP1) is associated with aggressive behavior, invasive clinical phenotype and poor clinical outcomes in various cancers. We studied whether SP1 exerts its effect on invasiveness and promotion of the epithelial-mesenchymal transition (EMT) by regulating lysyl oxidase-like 2
Moon-Chang Choi et al.
International journal of molecular sciences, 19(5) (2018-05-12)
Osteoarthritis (OA) is the most common and increasing joint disease worldwide. Current treatment for OA is limited to control of symptoms. The purpose of this study was to determine the effect of specificity protein 1 (SP1) inhibitor Mithramycin A (MitA)
Xuefeng Pan et al.
Molecular therapy. Nucleic acids, 22, 38-49 (2020-09-11)
Emerging studies indicate that long noncoding RNAs (lncRNAs) play crucial roles in ovarian cancer (OC). By analyzing high-throughput data, we found that SNHG17 was highly expressed in multiple OC cohorts. However, its functions in OC were not explored. In this
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico