Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

Ver Toda la documentación

EHU016751

Sigma-Aldrich

MISSION® esiRNA

targeting human CTGF

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
193,00 €
50 μG
342,00 €

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
193,00 €
50 μG
342,00 €

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTGCACCAGCATGAAGACATACCGAGCTAAATTCTGTGGAGTATGTACCGACGGCCGATGCTGCACCCCCCACAGAACCACCACCCTGCCGGTGGAGTTCAAGTGCCCTGACGGCGAGGTCATGAAGAAGAACATGATGTTCATCAAGACCTGTGCCTGCCATTACAACTGTCCCGGAGACAATGACATCTTTGAATCGCTGTACTACAGGAAGATGTACGGAGACATGGCATGAAGCCAGAGAGTGAGAGACATTAACTCATTAGACTGGAACTTGAACTGATTCACATCTCATTTTTCCGTAAAAATGATTTCAGTAGCACAAGTTATTTAAATCTGTTTTTCTAACTGGGGGAAAAGATTCCCACCCAATTCAAAACATTGTGCCATGTCAAACAAATAGTCTATCAACCCCAGACACTGGTTTGAAGAATGTTAAGACTTGACAGTGGAACTACATTAGTACACAGCACCAGAATGTATATTAAGGTGTGGCTTTAGGAGCA

Ensembl | nº de acceso humano

ENSG00000118523

Nº de acceso NCBI

NM_001901

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CTGF(1490) , CTGF(1490)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
SSU
FSU
QCS
SSS
RSS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Rohan Samarakoon et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 30(10), 3308-3320 (2016-06-23)
Protein phosphatase magnesium-dependent-1A (PPM1A) dephosphorylates SMAD2/3, which suppresses TGF-β signaling in keratinocytes and during Xenopus development; however, potential involvement of PPM1A in chronic kidney disease is unknown. PPM1A expression was dramatically decreased in the tubulointerstitium in obstructive and aristolochic acid
Arunachal Chatterjee et al.
PloS one, 12(12), e0190217-e0190217 (2017-12-30)
Perspectives on whether the functions of MAS, a G protein-coupled receptor, are beneficial or deleterious in the heart remain controversial. MAS gene knockout reduces coronary vasodilatation leading to ischemic injury. G protein signaling activated by MAS has been implicated in
Jung-Chien Cheng et al.
Oncotarget, 8(49), 85224-85233 (2017-11-22)
Ovarian low-grade serous carcinoma (LGSC) is a rare disease and is now considered to be a distinct entity from high-grade serous carcinoma (HGSC), which is the most common and malignant form of epithelial ovarian cancer. Connective tissue growth factor (CTGF)
Hiroshi Kinashi et al.
Scientific reports, 9(1), 12175-12175 (2019-08-23)
Lymphatic absorption in the peritoneal cavity may contribute to ultrafiltration failure in peritoneal dialysis (PD). Lymphatic vessels develop during PD-related peritoneal fibrosis. Connective tissue growth factor (CTGF, also called CCN2) is an important determinant of fibrotic tissue remodeling, but little
Erika Gucciardo et al.
International journal of molecular sciences, 19(12) (2018-12-16)
Diabetic retinopathy (DR) is the most common diabetic microvascular complication and major cause of blindness in working-age adults. According to the level of microvascular degeneration and ischemic damage, DR is classified into non-proliferative DR (NPDR), and end-stage, proliferative DR (PDR).
Ver todos los artículos relacionados

Preguntas

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico