Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

Ver Toda la documentación

EHU014711

Sigma-Aldrich

MISSION® esiRNA

targeting human A4GALT

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
193,00 €
50 μG
342,00 €

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
193,00 €
50 μG
342,00 €

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

193,00 €

Póngase en contacto con nuestro Servicio de Atención al Cliente para disponibilidad

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CATCATCGGCTTCAAGTTCACGTTTTTCGTCTCCATCATGATCTACTGGCACGTTGTGGGAGAGCCCAAGGAGAAAGGGCAGCTCTATAACCTGCCAGCAGAGATCCCCTGCCCCACCTTGACACCCCCCACCCCACCCTCCCACGGCCCCACTCCAGGCAACATCTTCTTCCTGGAGACTTCAGACCGGACCAACCCCAACTTCCTGTTCATGTGCTCGGTGGAGTCGGCCGCCAGAACTCACCCCGAATCCCACGTGCTGGTCCTGATGAAAGGGCTTCCGGGTGGCAACGCCTCTCTGCCCCGGCACCTGGGCATCTCACTTCTGAGCTGCTTCCCGAATGTCCAGATGCTCCCGCTGGACCTGCGGGAGCTGTTCCGGGACACACCCCTGGCCGACTGGTACGCGGCCGTGCAGGGGCGCTGGGAGCCCTACCTGCTGCCCGTGCTCTCCGACGCCTCCAGGATCGCACTCATGTGGAAGTTCGGCGGCATCTACCTGGACACGGAC

Ensembl | nº de acceso humano

ENSG00000128274

Nº de acceso NCBI

NM_017436

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... A4GALT(53947) , A4GALT(53947)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
JQS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Shigeki Sugawara et al.
Glycoconjugate journal, 34(1), 127-138 (2016-11-01)
Silurus asotus egg lectin (SAL), an α-galactoside-binding protein isolated from the eggs of catfish, is a member of the rhamnose-binding lectin family that binds to Gb3 glycan (Galα1-4Galβ1-4Glc). We have previously demonstrated that SAL reduces the proliferation of Gb3-expressing Burkitt's
Karl Johansson et al.
Frontiers in cellular and infection microbiology, 10, 212-212 (2020-06-12)
Shiga toxin is the main virulence factor of non-invasive enterohemorrhagic Escherichia coli strains capable of causing hemolytic uremic syndrome. Our group has previously shown that the toxin can reach the kidney within microvesicles where it is taken up by renal
Jonas Bergan et al.
Cellular and molecular life sciences : CMLS, 71(21), 4285-4300 (2014-04-18)
Shiga toxin-producing Escherichia coli bacteria cause hemorrhagic colitis and hemolytic uremic syndrome in humans. Currently, only supportive treatment is available for diagnosed patients. We show here that 24-h pretreatment with an ether lipid precursor, the alkylglycerol sn-1-O-hexadecylglycerol (HG), protects HEp-2

Preguntas

Revisiones

Sin puntuación

Filtros activos

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico