Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

View All Documentation

EHU007471

Sigma-Aldrich

MISSION® esiRNA

targeting human ST6GALNAC5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTACTCGCCACAAGATGCTGCAGTTTGATGAGCTCTTCAAGCAGGAGACTGGCAAAGACAGGAAGATATCCAACACTTGGCTCAGCACTGGCTGGTTTACAATGACAATTGCACTGGAGCTCTGTGACAGGATCAATGTTTATGGCATGGTGCCCCCAGACTTCTGCAGGGATCCCAATCACCCTTCAGTACCTTATCATTATTATGAACCTTTTGGACCTGATGAATGTACAATGTACCTCTCCCATGAGCGAGGACGCAAGGGCAGTCATCACCGCTTTATCACAGAGAAACGAGTCTTTAAGAACTGGGCACGGACATTCAATATTCACTTTTTTCAACCAGACTGGAAACCAGAATCACTTGCTATAAATCATCCTGAGAATAAACCTGTGTTCTAAGGAATGAGCATGCCAGACTGTAATCCCAGGTATTCACTGCATCAGACACCGAGACACTGAACTTCCTGAGCCACCAGACAGGAAAGGGTAGCAGAAAACAGCTTCACTCCTCAGGAAGTACCATGGACAGACGCC

Ensembl | nº de acceso humano

ENSG00000117069

Nº de acceso NCBI

NM_030965

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... ST6GALNAC5(81849) , ST6GALNAC5(81849)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Acciones bioquímicas o fisiológicas

ST6GALNAC5 (α-N-acetylgalactosaminide α-2,6-sialyltransferase 5) participates in the biosynthesis of α-series gangliosides. It is linked with breast cancer metastasis to the brain. ST6GALNAC5 reduces the association between breast cancer cells and human blood brain barrier. Mutations in this gene are associated with coronary artery disease.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

ST6GALNAC5 Expression Decreases the Interactions between Breast Cancer Cells and the Human Blood-Brain Barrier.
Drolez A et al.
International Journal of Molecular Sciences, 17, E1309-E1309 (2016)
Kolsoum InanlooRahatloo et al.
Scientific reports, 4, 3595-3595 (2014-01-09)
We aimed to identify the genetic cause of coronary artery disease (CAD) in an Iranian pedigree. Genetic linkage analysis identified three loci with an LOD score of 2.2. Twelve sequence variations identified by exome sequencing were tested for segregation with

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico