Skip to Content
Merck
All Photos(1)

Key Documents

EHU028021

Sigma-Aldrich

MISSION® esiRNA

targeting human MMP7

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAAGAGATCCCCCTGCATTTCAGGAAAGTTGTATGGGGAACTGCTGACATCATGATTGGCTTTGCGCGAGGAGCTCATGGGGACTCCTACCCATTTGATGGGCCAGGAAACACGCTGGCTCATGCCTTTGCGCCTGGGACAGGTCTCGGAGGAGATGCTCACTTCGATGAGGATGAACGCTGGACGGATGGTAGCAGTCTAGGGATTAACTTCCTGTATGCTGCAACTCATGAACTTGGCCATTCTTTGGGTATGGGACATTCCTCTGATCCTAATGCAGTGATGTATCCAACCTATGGAAATGGAGATCCCCAAAATTTTAAACTTTCCCAGGATGATATTAAAGGCATTCAGAAACTATATGGAAAGAGAAGTAATTCAAGAAAGAAATAGAAACTTCAGGCAGAACATCCATTCATTCATTCATTGGATTGTATATCATTGTTGCACAATCAGAATTGATAAGCACTGTTCCTCCACTCCAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Sojoong Choi et al.
Oncotarget, 6(6), 3874-3886 (2015-02-18)
Because earlier studies showed the cell surface heparan sulfate proteoglycan, syndecan-2, sheds from colon cancer cells in culture, the functional roles of shed syndecan-2 were assessed. A non-cleavable mutant of syndecan-2 in which the Asn148-Leu149 residues were replaced with Asn148-Ile149
Ahmad Ghasemi et al.
Journal of cellular biochemistry, 119(2), 2333-2344 (2017-09-09)
Leptin, an adipokine secreted by adipose tissue, induces cell invasion and metastasis. MMP7 is a member of the matrix metalloproteinase family that plays an important role in cell invasion. Here we evaluate the possible role and underlying mechanism of MMP7
Q Zhang et al.
Oncogene, 36(5), 687-699 (2016-07-05)
Chronic inflammation has been associated with a variety of human cancers including prostate cancer. Interleukin-17 (IL-17) is a critical pro-inflammatory cytokine, which has been demonstrated to promote development of prostate cancer, colon cancer, skin cancer, breast cancer, lung cancer and
Hua Li et al.
Anti-cancer agents in medicinal chemistry, 18(14), 2010-2016 (2018-12-07)
Gastric adenocarcinoma is one of the most common and lethal cancer types and is known as the second leading cause of cancer-related death of Asian adults, early diagnosis based on either pathology or molecular biology could be one of the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service