Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

HLTUD002C

Sigma-Aldrich

MISSION® Lenti microRNA Inhibitor

cel-miR-243-3p, Negative Control 2, Sequence from Caenorhabditis elegans with no homology to human and mouse gene sequences

Synonym(e):

Tough Decoy, TuD

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41106609
NACRES:
NA.51

Produktlinie

MISSION®

Form

liquid

Konzentration

≥1x106 VP/ml (via p24 assay)

Ausgereifte Sequenz

CGGUACGAUCGCGGCGGGAUAUC

Sanger-Hinterlegungsnummer ausgereifte/nicht ausgereifte Sequenzen

MIMAT0000299

Sanger microRNA-Hinterlegungsnummer

MI0000319

Versandbedingung

dry ice

Lagertemp.

−70°C

Suchen Sie nach ähnlichen Produkten? Aufrufen Leitfaden zum Produktvergleich

Allgemeine Beschreibung

Individual lenti microRNA inhibitors are designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. The lentiviral microRNA Inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included, allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells.

  • Allows for potent inhibition of the desired miRNA
  • Lentiviral delivery format allows for efficient delivery of the inhibitor into a wide variety of cell types
  • Enables long-term inhibition without repeat transfection

Sonstige Hinweise

Based on miRBase V19 Mature ID

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

12 - Non Combustible Liquids

WGK

WGK 3

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Ruben Aquino-Martinez et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 34(1), 135-144 (2018-10-16)
Developing novel approaches to treat skeletal disorders requires an understanding of how critical molecular factors regulate osteoblast differentiation and bone remodeling. We have reported that (1) retinoic acid receptor-related orphan receptor beta (Rorβ) is upregulated in bone samples isolated from
Yang Wang et al.
Journal of cellular biochemistry (2019-03-02)
Spinal cord injury (SCI) has been a major burden on the society because of the high rate of disability. Receptor-interacting protein 3 (RIP3)-mediated necroptosis is a newly discovered pathway of programmed cell death and is involved in multiple pathologies of

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.