Direkt zum Inhalt
Merck

EMU164891

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Npm1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
194,00 €
50 μG
343,00 €

194,00 €


Voraussichtliches Versanddatum27. April 2025



Größe auswählen

Ansicht ändern
20 μG
194,00 €
50 μG
343,00 €

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

194,00 €


Voraussichtliches Versanddatum27. April 2025


Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TGGAAGACTCGATGGATATGGACATGAGTCCTCTTAGGCCTCAGAACTACCTTTTCGGCTGTGAACTAAAGGCTGACAAAGACTATCACTTTAAAGTGGATAATGATGAAAATGAGCACCAGTTGTCATTAAGAACGGTCAGTTTAGGAGCAGGGGCAAAAGATGAGTTACACATCGTAGAGGCAGAAGCAATGAACTATGAAGGCAGTCCAATTAAAGTAACACTGGCAACTTTGAAAATGTCTGTACAACCAACAGTTTCCCTAGGGGGCTTTGAAATTACACCACCTGTGGTCTTACGGTTGAAGTGTGGTTCAGGGCCTGTGCACATTAGTGGACAGCATCTAGTAGCTGTAGAGGAAGATGCAGAGTCTGAAGATGAAGATGAGGAGGACGTAAAACTCTTAGGCATGTCTGGAAAGCGATCTGCTCCTGGAGGTGGTAACAAGGTTCCACAGAAAAAAGTAAAACTTGATGAAGATGATGAGGACGATGATGAGGACGATGAGGATG

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Dokumente section.

Wenn Sie Hilfe benötigen, wenden Sie sich bitte an Kundensupport

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Dominique Thuringer et al.
Oncotarget, 6(12), 10267-10283 (2015-04-15)
High levels of circulating heat shock protein 70 (HSP70) are detected in many cancers. In order to explore the effects of extracellular HSP70 on human microvascular endothelial cells (HMEC), we initially used gap-FRAP technique. Extracellular human HSP70 (rhHSP70), but not
Tetsuya Muto et al.
Investigative ophthalmology & visual science, 55(7), 4327-4337 (2014-06-19)
To investigate whether high glucose (HG) alters connexin 43 (Cx43) expression and gap junction intercellular communication (GJIC) activity in retinal Müller cells, and promotes Müller cell and pericyte loss. Retinal Müller cells (rMC-1) and cocultures of rMC-1 and retinal pericytes
Tobias Forster et al.
Oncotarget, 5(6), 1621-1634 (2014-04-20)
The extreme aggressiveness of pancreatic ductal adenocarcinoma (PDA) has been associated with blocked gap junctional intercellular communication (GJIC) and the presence of cancer stem cells (CSCs). We examined whether disturbed GJIC is responsible for a CSC phenotype in established and
Lingzhi Wang et al.
Oncology reports, 34(4), 2133-2141 (2015-08-12)
Cisplatin, an important chemotherapeutic agent against testicular germ cell cancer, induces testicular toxicity on Leydig and Sertoli cells, leading to serious side-effects such as azoospermia and infertility. In a previous study, it was found that simvastatin enhanced the sensitivity of
S Morel et al.
Thrombosis and haemostasis, 112(2), 390-401 (2014-05-16)
Ubiquitous reduction of the gap junction protein Connexin43 (Cx43) in mice provides beneficial effects on progression and composition of atherosclerotic lesions. Cx43 is expressed in multiple atheroma-associated cells but its function in each cell type is not known. To examine

Fragen

Bewertungen

Kein Beurteilungswert

Aktive Filter

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.