Direkt zum Inhalt
Merck

EMU085661

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mecp2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
194,00 €
50 μG
343,00 €

194,00 €


Check Cart for Availability


Größe auswählen

Ansicht ändern
20 μG
194,00 €
50 μG
343,00 €

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

194,00 €


Check Cart for Availability

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCGTGACCGAGAGAGTTAGCTGACTTTACATAGAGCGGATTGCAAAGCAAACCAACAAGAATAAAGGCAGCTGTTGTCTCTTCTCCTTATGGGTAGGGCTCTGACAAAGCTTCCCGATTAACTGAAATAAAAAATATTTTTTTTTCTTTCAGTAAACTTAGAGTTTCGTGGCTTCGGGGTGGGAGTAGTTGGAGCATTGGGATGTTTTTCTTACCGACAAGCACAGTCAGGTTGAAGACCTAACCAGGGCCAGAAGTAGCTTTGCACTTTTCTAAACTAGGCTCCTTCAACAAGGCTTGCTGCAGATACTACTGACCAGACAAGCTGTTGACCAGGCACTCCCCCCAACAATATCCTCCCTCTTCCCCCCCCCCACCCCCGCCCCGTGTGCTCGTTAGGGCAATTGAGAGGACACTCCCATTTTTGGTGCCATTGATGCCCTGTCCATAATAGCTTCCCTGACTTTTACACCACCCCAACTCCCAATCTGAAGGACTGGGAGGTGTGATG

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Ryuta Tanimoto et al.
Endocrinology, 156(1), 58-70 (2014-11-05)
The growth factor progranulin is as an important regulator of transformation in several cellular systems. We have previously demonstrated that progranulin acts as an autocrine growth factor and stimulates motility, proliferation, and anchorage-independent growth of castration-resistant prostate cancer cells, supporting
Riddhi Atul Jani et al.
Journal of cell science, 128(17), 3263-3276 (2015-07-26)
Melanosomes are a class of lysosome-related organelles produced by melanocytes. Biogenesis of melanosomes requires the transport of melanin-synthesizing enzymes from tubular recycling endosomes to maturing melanosomes. The SNARE proteins involved in these transport or fusion steps have been poorly studied.
V O Okoh et al.
British journal of cancer, 112(10), 1687-1702 (2015-05-13)
17β-Oestradiol (E2)-induced reactive oxygen species (ROS) have been implicated in regulating the growth of breast cancer cells. However, the underlying mechanism of this is not clear. Here we show how ROS through a novel redox signalling pathway involving nuclear respiratory
Anja Rogler et al.
Journal of cancer research and clinical oncology, 141(10), 1779-1790 (2015-03-04)
We previously showed that the Wnt-signaling antagonist SFRP1 (secreted frizzled-related protein 1) is a promising marker in bladder cancer. The aim of this study was to validate the prognostic role and analyze the functional significance of SFRP1. Four bladder cancer
Balaram Thota et al.
Journal of neurosurgery, 121(2), 374-383 (2014-06-01)
Insulin-like growth factor binding proteins (IGFBPs) have been implicated in the pathogenesis of glioma. In a previous study the authors demonstrated that IGFBP-3 is a novel glioblastoma biomarker associated with poor survival. Since signal transducer and activator of transcription 1

Fragen

Bewertungen

Kein Beurteilungswert

Aktive Filter

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.