Direkt zum Inhalt
Merck

EMU074451

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mapk8

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
194,00 €
50 μG
343,00 €

194,00 €


Check Cart for Availability


Größe auswählen

Ansicht ändern
20 μG
194,00 €
50 μG
343,00 €

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

194,00 €


Check Cart for Availability

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCATCATGAGCAGAAGCAAACGTGACAACAATTTTTATAGTGTAGAGATTGGAGATTCTACATTCACAGTCCTAAAACGATACCAGAATTTAAAGCCTATAGGCTCAGGAGCTCAAGGAATAGTGTGTGCAGCTTATGATGCCATTCTTGAAAGAAATGTTGCAATCAAGAAGCTCAGCCGGCCATTTCAGAATCAGACCCATGCTAAGCGCGCCTACCGAGAACTAGTTCTTATGAAGTGTGTTAATCACAAAAATATAATTGGCCTTTTGAATGTTTTCACACCACAGAAATCCCTAGAAGAATTTCAAGATGTTTACATAGTCATGGAGCTCATGGATGCAAATCTTTGCCAAGTGATTCAGATGGAGTTAGATCATGAAAGAATGTCCTACCTTCTCTATCAAATGCTGTGTGGAATCAAGCACCTTCACTCTGCTG

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

12 - Non Combustible Liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Xu Qin et al.
Molecular carcinogenesis, 53(7), 526-536 (2013-01-30)
The c-Jun NH2 -terminal kinase (JNK) signal pathway has been implicated in the growth, cellular proliferation, and apoptosis in many kinds of carcinomas. However, the role of JNK in the development of esophageal squamous cell carcinomas (ESCCs) is unknown. To
Shantel Olivares et al.
PloS one, 9(7), e103828-e103828 (2014-08-01)
Endoplasmic reticulum (ER) stress is induced in many forms of chronic liver disease and may promote the development of hepatocellular carcinoma. The activator protein 1 (AP-1) complex is a transcription factor that promotes hepatic carcinogenesis in response to cellular stress.
Wen-Pin Cheng et al.
PloS one, 10(4), e0123235-e0123235 (2015-04-22)
The expression of TRB3 (tribbles 3), an apoptosis regulated gene, increases during endoplasmic reticulum (ER) stress. How mechanical stress affects the regulation of TRB3 in cardiomyocytes during apoptosis is not fully understood. An in vivo model of aorta-caval shunt in
Wen-Tsong Hsieh et al.
Journal of neuro-oncology, 118(2), 257-269 (2014-04-24)
Glioblastoma multiforme (GBM) is the most common and lethal type of primary brain tumor characterized by its rapid infiltration to surrounding tissues during the early stages. The fast spreading of GBM obscures the initiation of the tumor mass making the
Lina Liang et al.
PloS one, 10(5), e0126384-e0126384 (2015-05-16)
The incidence of obesity is increasing worldwide. It was reported that endoplasmic reticulum stress (ERS) could inhibit insulin receptor signaling by activating c-Jun N-terminal kinase (JNK) in the liver. However, the relationship between ERS and insulin receptor signaling in the

Fragen

Bewertungen

Kein Beurteilungswert

Aktive Filter

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.