Direkt zum Inhalt
Merck

EMU026071

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Axl

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
194,00 €
50 μG
343,00 €

194,00 €


Voraussichtliches Versanddatum23. Mai 2025



Größe auswählen

Ansicht ändern
20 μG
194,00 €
50 μG
343,00 €

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

194,00 €


Voraussichtliches Versanddatum23. Mai 2025


Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CAGGTACCGTGTCCGAAAGTCCTACAGCCGGCGGACCACTGAAGCCACCTTGAACAGTCTGGGCATCAGTGAAGAGCTGAAGGAGAAACTACGAGACGTCATGGTAGATCGGCATAAGGTGGCCTTGGGGAAGACCCTGGGAGAAGGAGAATTTGGCGCTGTGATGGAAGGTCAGCTCAATCAGGATGACTCCATCCTCAAGGTCGCTGTGAAGACCATGAAAATTGCCATCTGCACAAGATCAGAGCTGGAGGATTTCCTGAGTGAAGCTGTCTGCATGAAGGAATTTGACCACCCCAACGTCATGAGGCTCATTGGCGTCTGTTTTCAGGGCTCTGACAGAGAGGGTTTCCCAGAACCTGTGGTCATCTTGCCTTTCATGAAACACGGAGACCTACACAGTTTCCTCCTGTACTCCCGGCTCGGGGACCAGCCAGTGTTCCTGCCCACTCAGAT

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Toni M Brand et al.
Cancer research, 74(18), 5152-5164 (2014-08-20)
The EGFR antibody cetuximab is used to treat numerous cancers, but intrinsic and acquired resistance to this agent is a common clinical outcome. In this study, we show that overexpression of the oncogenic receptor tyrosine kinase AXL is sufficient to
Catherine Wilson et al.
Cancer research, 74(20), 5878-5890 (2014-08-16)
Molecularly targeted drug therapies have revolutionized cancer treatment; however, resistance remains a major limitation to their overall efficacy. Epithelial-to-mesenchymal transition (EMT) has been linked to acquired resistance to tyrosine kinase inhibitors (TKI), independent of mutational resistance mechanisms. AXL is a
Rui Li et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(9), 7277-7283 (2015-04-22)
Increasing evidence has suggested that dysregulation of microRNAs (miRNAs) could contribute to tumor progression. The miR-34 family is directly transactivated by tumor suppressor p53 which is frequently mutated in various cancers; however, the effect of miR-34a on the ovarian cancer
Nam-Yi Kim et al.
International journal of oncology, 47(1), 353-360 (2015-05-16)
Metformin, the most frequently prescribed anti-diabetic drug, has recently been paid attention as a chemotherapeutic agent. In this study, we demonstrated that metformin decreased the viability of parental as well as cisplatin/taxol-resistant ovarian cancer cells. Its anti-proliferative effect was further

Fragen

Bewertungen

Kein Beurteilungswert

Aktive Filter

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.