Direkt zum Inhalt
Merck

EHU156721

Sigma-Aldrich

MISSION® esiRNA

targeting human ECM1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
194,00 €
50 μG
343,00 €

194,00 €


Voraussichtliches Versanddatum30. April 2025



Größe auswählen

Ansicht ändern
20 μG
194,00 €
50 μG
343,00 €

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

194,00 €


Voraussichtliches Versanddatum30. April 2025


Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCCTTTGAGGGACAGAGTCAAGTGCAGCCCCCTCCCTCTCAGGAGGCCACCCCTCTCCAACAGGAAAAGCTGCTACCTGCCCAACTCCCTGCTGAAAAGGAAGTGGGTCCCCCTCTCCCTCAGGAAGCTGTCCCCCTCCAAAAAGAGCTGCCCTCTCTCCAGCACCCCAATGAACAGAAGGAAGGAACGCCAGCTCCATTTGGGGACCAGAGCCATCCAGAACCTGAGTCCTGGAATGCAGCCCAGCACTGCCAACAGGACCGGTCCCAAGGGGGCTGGGGCCACCGGCTGGATGGCTTCCCCCCTGGGCGGCCTTCTCCAGACAATCTGAACCAAATCTGCCTTCCTAACCGTCAGCATGTGGTATATGGTCCCTGGAACCTACCACAGTCCAGCTACTCCCACCTCACTCGCCAGGGTGAGACCCTCAATTTCCTGGAGATTGGATATTCCCGCTGCTGCCACTGCCGCAGCCACACAAACCGCCTAGAGT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Cuixian Li et al.
PloS one, 6(10), e27053-e27053 (2011-11-03)
Malignant gliomas represent one of the most aggressive types of cancers and their recurrence is closely linked to acquired therapeutic resistance. A combination of chemotherapy is considered a promising therapeutic model in overcoming therapeutic resistance and enhancing treatment efficacy. Herein
Lin-Qing Liu et al.
Food and chemical toxicology : an international journal published for the British Industrial Biological Research Association, 133, 110779-110779 (2019-09-01)
MicroRNAs were known to play very important roles in human diseases, and have attracted great interests of research scientists in medicine, toxicology and functional foods. Gastric carcinoma (GC) remains one of the most common and lethal types of malignancy worldwide.
Sophie Sarah Steinhaeuser et al.
Laboratory investigation; a journal of technical methods and pathology, 100(7), 928-944 (2020-03-24)
The tumor microenvironment is increasingly recognized as key player in cancer progression. Investigating heterotypic interactions between cancer cells and their microenvironment is important for understanding how specific cell types support cancer. Forming the vasculature, endothelial cells (ECs) are a prominent
Jie Chen et al.
Oncogene, 38(14), 2533-2550 (2018-12-12)
Many reports have described DGKα as an oncogene, hence, we investigated its function and the underlying mechanisms in esophageal squamous cell carcinoma (ESCC) progression. This study demonstrated that DGKα was upregulated by inflammatory stimulants and formed feedforward loop with Akt/NF-κB
Ariel E Cariaga-Martínez et al.
Biology open, 3(10), 924-936 (2014-09-14)
The acquisition of invasiveness is characteristic of tumor progression. Numerous genetic changes are associated with metastasis, but the mechanism by which a cell becomes invasive remains unclear. Expression of p85β, a regulatory subunit of phosphoinositide-3-kinase, markedly increases in advanced carcinoma

Fragen

Bewertungen

Kein Beurteilungswert

Aktive Filter

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.