Direkt zum Inhalt
Merck

EHU153211

Sigma-Aldrich

MISSION® esiRNA

targeting human TUBB3, RP11-566K11.2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
194,00 €
50 μG
343,00 €

194,00 €


Voraussichtliches Versanddatum24. April 2025



Größe auswählen

Ansicht ändern
20 μG
194,00 €
50 μG
343,00 €

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

194,00 €


Voraussichtliches Versanddatum24. April 2025


Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CATTCTGGTGGACCTGGAACCCGGAACCATGGACAGTGTCCGCTCAGGGGCCTTTGGACATCTCTTCAGGCCTGACAATTTCATCTTTGGTCAGAGTGGGGCCGGCAACAACTGGGCCAAGGGTCACTACACGGAGGGGGCGGAGCTGGTGGATTCGGTCCTGGATGTGGTGCGGAAGGAGTGTGAAAACTGCGACTGCCTGCAGGGCTTCCAGCTGACCCACTCGCTGGGGGGCGGCACGGGCTCCGGCATGGGCACGTTGCTCATCAGCAAGGTGCGTGAGGAGTATCCCGACCGCATCATGAACACCTTCAGCGTCGTGCCCTCACCCAAGGTGTCAGACACGGTGGTGGAGCCCTACAACGCCACGCTGTCCATCCACCAGCTGGTGGAGAACACGGATGAGACCTACTGCATCGACAACGAG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Yohei Sekino et al.
Oncology, 98(10), 689-698 (2020-06-26)
βIII-Tubulin, encoded by the TUBB3 gene, is a microtubule protein. Several studies have shown that overexpression of TUBB3 is linked to poor prognosis and is involved in taxane resistance in some cancers. The aim of this study was to analyze
Yohei Sekino et al.
Anticancer research, 40(4), 1943-1951 (2020-04-03)
Targeted receptor tyrosine kinase inhibitor (TKI) is a standard treatment in advanced renal cell carcinoma (RCC). However, the role of PTEN in TKI resistance remains poorly understood. We aimed to determine the functional role of PTEN knockout and analyse the
Sidika Öztop et al.
Anticancer research, 39(2), 655-662 (2019-02-04)
The challenges of cololorectal cancer (CRC) management include prediction of outcome and drug response or chemoresistance. This study aimed at examining whether βIII-tubulin (TUBB3), present in various types of normal tissues and cancer, is a biomarker for the response of
Mihoko A Tame et al.
Oncotarget, 8(42), 71536-71547 (2017-10-27)
Microtubules are cellular targets for a variety of anticancer therapies because of their critical function in mitosis. Taxol belongs to a class of microtubule targeting agents that suppresses microtubule dynamics and interferes with the functioning of the mitotic spindle, thereby
Qian Liu et al.
Aging, 12(4), 3713-3729 (2020-02-29)
P-glycoprotein (P-gp) and βIII-tubulin overexpression-mediated drug resistance leads to clinical therapy failure for paclitaxel. However, the development of paclitaxel-resistance reversal agents has not had much success. In this study, EM-E-11-4, a lathyrane-type diterpenoid extracted from Euphorbia micractina, demonstrated good anti-MDR

Fragen

Bewertungen

Kein Beurteilungswert

Aktive Filter

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.