Direkt zum Inhalt
Merck

EHU147931

Sigma-Aldrich

MISSION® esiRNA

targeting human AREG

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
194,00 €
50 μG
343,00 €

194,00 €


Check Cart for Availability


Größe auswählen

Ansicht ändern
20 μG
194,00 €
50 μG
343,00 €

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

194,00 €


Check Cart for Availability

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AAAAAGGGAGGCAAAAATGGAAAAAATAGAAGAAACAGAAAGAAGAAAAATCCATGTAATGCAGAATTTCAAAATTTCTGCATTCACGGAGAATGCAAATATATAGAGCACCTGGAAGCAGTAACATGCAAATGTCAGCAAGAATATTTCGGTGAACGGTGTGGGGAAAAGTCCATGAAAACTCACAGCATGATTGACAGTAGTTTATCAAAAATTGCATTAGCAGCCATAGCTGCCTTTATGTCTGCTGTGATCCTCACAGCTGTTGCTGTTATTACAGTCCAGCTTAGAAGACAATACGTCAGGAAATATGAAGGAGAAGCTGAGGAACGAAAGAAACTTCGACAAGAGAATGGAAATGTACATGCTATAGCATAACTGAAGATAAAATTACAGGATATCACATTGGAGTCACTGCCAAGTCATAGCCA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Jian Wang et al.
Cellular signalling, 53, 122-131 (2018-10-07)
Ambient particulate matter (PM) promotes the development and exacerbation of chronic respiratory diseases, including chronic obstructive pulmonary disease (COPD) and asthma, by increasing inflammation and mucus hypersecretion. However, the biological mechanisms underlying PM-induced airway inflammation and mucus hypersecretion remain unclear.
Simona Taverna et al.
Scientific reports, 7(1), 3170-3170 (2017-06-11)
Non-small cell lung cancer (NSCLC) remains the leading cause of cancer-related deaths worldwide. The majority of patients are diagnosed in advanced disease stage. Bone metastasis is the most frequent complication in NSCLC resulting in osteolytic lesions. The perfect balance between
Shuntaro Tokunaga et al.
Anticancer research, 37(5), 2225-2231 (2017-05-10)
Amrubicin (AMR) has shown promising activity for lung cancer. However, little is known about the mechanism underlying resistance to this agent. The aim of this study was to elucidate the mechanism underlying resistance to AMR. We first developed amrubicinol (AMR-OH)-resistant
Yuanzhong Wang et al.
Endocrine-related cancer, 27(12), 671-683 (2020-10-29)
Acquired resistance to aromatase inhibitors (AIs) is a significant clinical issue in endocrine therapy for estrogen receptor (ER) positive breast cancer which accounts for the majority of breast cancer. Despite estrogen production being suppressed, ERα signaling remains active and plays
Luofu Wang et al.
PloS one, 9(5), e96586-e96586 (2014-05-07)
The objective of this study was to investigate nanobubbles carrying androgen receptor (AR) siRNA and their in vitro and in vivo anti-tumor effects, when combined with ultrasonic irradiation, on androgen-independent prostate cancer (AIPC). Nanobubbles carrying AR siRNA were prepared using

Fragen

Bewertungen

Kein Beurteilungswert

Aktive Filter

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.