Direkt zum Inhalt
Merck

EHU126361

Sigma-Aldrich

MISSION® esiRNA

targeting human SERPINB5

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
194,00 €
50 μG
343,00 €

194,00 €


Versandbereit am22. April 2025Details



Größe auswählen

Ansicht ändern
20 μG
194,00 €
50 μG
343,00 €

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

194,00 €


Versandbereit am22. April 2025Details


Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TGCAAATGAAATTGGACAGGTTCTTCATTTTGAAAATGTCAAAGATGTACCCTTTGGATTTCAAACAGTAACATCGGATGTAAACAAACTTAGTTCCTTTTACTCACTGAAACTAATCAAGCGGCTCTACGTAGACAAATCTCTGAATCTTTCTACAGAGTTCATCAGCTCTACGAAGAGACCGTATGCAAAGGAATTGGAAACTGTTGACTTCAAAGATAAATTGGAAGAAACGAAAGGTCAGATCAACAACTCAATTAAGGATCTCACAGATGGCCACTTTGAGAACATTTTAGCTGACAACAGTGTGAACGACCAGACCAAAATCCTTGTGGTTAATGCTGCCTACTTTGTTGGCAAGTGGATGAAGAAATTTTCTGAATCAGAAACAAAAGAATGTCCTTTCAGAGTCAACAAGACAGACACCAAACCAGTGCAGATGATGAACATGGAGGCC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Feng Qiu et al.
Bioscience, biotechnology, and biochemistry, 82(8), 1366-1376 (2018-04-17)
The aim of the present study is to investigate the role of miR-21-5p in angiogenesis of human retinal microvascular endothelial cells (HRMECs). HRMECs were incubated with 5 mM glucose, 30 mM glucose or 30 mM mannitol for 24 h, 48 h or 72 h. Then, HRMECs
Ning Wang et al.
Human cell, 33(3), 663-675 (2020-05-16)
This study aims to investigate how Maspin affects the EMT and angiogenesis of gastric cancer (GC) cells via ITGB1/FAK pathway. Immunohistochemistry was used to evaluate the expressions of Maspin, ITGB1, FAK, E-cadherin, Vimentin, D2-40, and CD34 in GC and adjacent
Yu-Hsiang Lin et al.
Cancers, 12(1) (2019-12-22)
Maspin is a member of the clade B serine protease inhibitor superfamily and exhibits diverse regulatory effects in various types of solid tumors. We compared the expressions of maspin and determined its potential biological functions and regulatory mechanisms in bladder
Chikako Takeda et al.
Diagnostic pathology, 9, 205-205 (2014-11-02)
Maspin is a 42 kDa protein known to act as a tumor suppressor. Although its function has not been fully elucidated, numerous reports have investigated the prognostic impact of maspin in patients with several types of cancer. However, there have
Bo Mi Ku et al.
PloS one, 13(4), e0194730-e0194730 (2018-04-12)
AZD9291 (osimertinib) is approved for standard care in patients with EGFR T790M-positive non-small cell lung cancer (NSCLC) after prior EGFR TKI progression. Furthermore, AZD9291 is now being evaluated as a first-line treatment for NSCLC patients with activation EGFR mutations. Based

Fragen

Bewertungen

Kein Beurteilungswert

Aktive Filter

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.