Direkt zum Inhalt
Merck

EHU105871

Sigma-Aldrich

MISSION® esiRNA

targeting human HMGB2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
194,00 €
50 μG
343,00 €

194,00 €


Check Cart for Availability


Größe auswählen

Ansicht ändern
20 μG
194,00 €
50 μG
343,00 €

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

194,00 €


Check Cart for Availability

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TTACGTTCCTCCCAAAGGTGATAAGAAGGGGAAGAAAAAGGACCCCAATGCTCCTAAAAGGCCACCATCTGCCTTCTTCCTGTTTTGCTCTGAACATCGCCCAAAGATCAAAAGTGAACACCCTGGCCTATCCATTGGGGATACTGCAAAGAAATTGGGTGAAATGTGGTCTGAGCAGTCAGCCAAAGATAAACAACCATATGAACAGAAAGCAGCTAAGCTAAAGGAGAAATATGAAAAGGATATTGCTGCATATCGTGCCAAGGGCAAAAGTGAAGCAGGAAAGAAGGGCCCTGGCAGGCCAACAGGCTCAAAGAAGAAGAACGAACCAGAAGATGAGGAGGAGGAGGAGGAAGAAGAAGATGAAGATGAGGAGGAAGAGGATGAAGATGAAGAATAAATGGCTATCCTTTAATGATGCGTGTGGAATGTGT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Hongjuan Li et al.
American journal of cancer research, 8(5), 835-851 (2018-06-12)
Ovarian carcinoma is a fatal malignancy in gynecological malignancies, and the prognosis still remains poor due to the lack of effective therapeutic targets. This study demonstrated that centromere protein U (CENPU) was up-regulated in ovarian cancer. The ectopic expression of
Deokcheol Lee et al.
Scientific reports, 8(1), 9601-9601 (2018-06-27)
Although various surgical procedures have been developed for chronic rotator cuff tear repair, the re-tear rate remains high with severe fat infiltration. However, little is known about the molecular regulation of this process. Mesenchymal stem cells (MSCs) in the intra-muscular
María Cámara-Quílez et al.
Cancers, 12(9) (2020-09-02)
High mobility group box B (HMGB) proteins are overexpressed in different types of cancers such as epithelial ovarian cancers (EOC). We have determined the first interactome of HMGB1 and HMGB2 in epithelial ovarian cancer (the EOC-HMGB interactome). Libraries from the
Cuiping Zhang et al.
Haematologica, 105(3), 573-584 (2019-06-07)
Hematopoietic stem cells provide life-long production of blood cells and undergo self-renewal division in order to sustain the stem cell pool. Homeostatic maintenance of hematopoietic stem cell pool and blood cell production is vital for the organism to survive. We

Fragen

Bewertungen

Kein Beurteilungswert

Aktive Filter

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.