Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU099501

Sigma-Aldrich

MISSION® esiRNA

targeting human F11R

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCCTTTCCTACCACTGCTGAGTGGCCTGGAACTTGTTTAAAGTGTTTATTCCCCATTTCTTTGAGGGATCAGGAAGGAATCCTGGGTATGCCATTGACTTCCCTTCTAAGTAGACAGCAAAAATGGCGGGGGTCGCAGGAATCTGCACTCAACTGCCCACCTGGCTGGCAGGGATCTTTGAATAGGTATCTTGAGCTTGGTTCTGGGCTCTTTCCTTGTGTACTGACGACCAGGGCCAGCTGTTCTAGAGCGGGAATTAGAGGCTAGAGCGGCTGAAATGGTTGTTTGGTGATGACACTGGGGTCCTTCCATCTCT

Ensembl | Human Hinterlegungsnummer

ENSG00000158769

NCBI-Hinterlegungsnummer

NM_144504

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... F11R(50848) , F11R(50848)

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Jonas Franz et al.
PloS one, 11(1), e0146598-e0146598 (2016-01-06)
Endothelial barriers have a central role in inflammation as they allow or deny the passage of leukocytes from the vasculature into the tissue. To bind leukocytes, endothelial cells form adhesive clusters containing tetraspanins and ICAM-1, so-called endothelial adhesive platforms (EAPs).
Min Xie et al.
Cancer letters, 443, 67-79 (2018-12-07)
Multiple studies have revealed that long non-coding RNAs (lncRNAs) extensively participate in human cancer malignant progression. The long intergenic non-protein coding RNA 707 (LINC00707), 3087 bp in length, was recently reported to be an essential oncogene in promoting lung adenocarcinoma
Rodrigo G B Cruz et al.
Cancers, 13(4) (2021-03-07)
The success of breast cancer therapies targeting the human epidermal growth factor receptor-2 (HER2) is limited by the development of drug resistance by mechanisms including upregulation of HER3. Having reported that HER2 expression and resistance to HER2-targeted therapies can be
Nikola Sladojevic et al.
Neurobiology of disease, 67, 57-70 (2014-03-25)
Proinflammatory mediators trigger intensive postischemic inflammatory remodeling of the blood-brain barrier (BBB) including extensive brain endothelial cell surface and junctional complex changes. Junctional adhesion molecule-A (JAM-A) is a component of the brain endothelial junctional complex with dual roles: paracellular route
Hüseyin Tuncay et al.
Nature communications, 6, 8128-8128 (2015-08-27)
Planar spindle orientation in polarized epithelial cells depends on the precise localization of the dynein-dynactin motor protein complex at the lateral cortex. The contribution of cell adhesion molecules to the cortical localization of the dynein-dynactin complex is poorly understood. Here

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.