Direkt zum Inhalt
Merck
Alle Fotos(1)

Wichtige Dokumente

EHU093841

Sigma-Aldrich

MISSION® esiRNA

targeting human RORC

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
194,00 €
50 μG
343,00 €

194,00 €

Check Cart for Availability
Alle Fotos(1)

Größe auswählen

Ansicht ändern
20 μG
194,00 €
50 μG
343,00 €

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

194,00 €

Check Cart for Availability

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GAGGAAGTCCATGTGGGAGATGTGGGAACGGTGTGCCCACCACCTCACCGAGGCCATTCAGTACGTGGTGGAGTTCGCCAAGAGGCTCTCAGGCTTTATGGAGCTCTGCCAGAATGACCAGATTGTGCTTCTCAAAGCAGGAGCAATGGAAGTGGTGCTGGTTAGGATGTGCCGGGCCTACAATGCTGACAACCGCACGGTCTTTTTTGAAGGCAAATACGGTGGCATGGAGCTGTTCCGAGCCTTGGGCTGCAGCGAGCTCATCAGCTCCATCTTTGACTTCTCCCACTCCCTAAGTGCCTTGCACTTTTCCGAGGATGAGATTGCCCTCTACACAGCCCTTGTTCTCATCAATGCCCATCGGCCAGGGCTCCAAGAGAAAAGGAAAGTAGAACAGCTGCAGTACAATCTGGAGCTGGCCTT

Ensembl | Human Hinterlegungsnummer

ENSG00000143365

NCBI-Hinterlegungsnummer

NM_001001523

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... RORC(6097) , RORC(6097)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number
QCS

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Suche nach COA

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Yun-Jeong Jeong et al.
Food and chemical toxicology : an international journal published for the British Industrial Biological Research Association, 68, 218-225 (2014-03-29)
Bee venom is a natural compound produced by the honey bee (Apis mellifera), and has been reported as having the biological and pharmacological activities, including anti-bacterial, anti-viral and anti-inflammation. In the present study, the inhibitory effects of bee venom and
Geyang Xu et al.
Molecular and cellular endocrinology, 416, 9-18 (2015-08-19)
Glucagon-like peptide (GLP-1), an intestinal incretin produced in L-cells and released in response to meal intake, functions to promote insulin secretion and to decrease plasma glucose. Ghrelin is an orexigenic hormone critical for glucose homeostasis. The molecular mechanism by which
Hong Zhang et al.
International journal of molecular sciences, 19(4) (2018-04-05)
20(S)-Protopanaxadiol (PPD) is one of the major active metabolites of ginseng. It has been reported that 20(S)-PPD shows a broad spectrum of antitumor effects. Our research study aims were to investigate whether apoptosis of human breast cancer MCF-7 cells could
Jia-Hui Rong et al.
OncoTargets and therapy, 14, 289-300 (2021-01-21)
In recent years, radioactive 125I seed implantation combined with chemotherapy has been regarded as a safe and effective treatment for advanced non-small cell lung cancer (NSCLC). However, the mechanism underlying this success is still unclear. In this study, we investigated
Nishant S Gandhi et al.
Pharmaceutical research, 35(10), 188-188 (2018-08-15)
Lung cancer is one of the leading causes of deaths in the United States, but currently available therapies for lung cancer are associated with reduced efficacy and adverse side effects. Small interfering RNA (siRNA) can knock down the expression of
Alle zugehörigen Dokumente anzeigen

Fragen

Bewertungen

Kein Beurteilungswert

Aktive Filter

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.