Direkt zum Inhalt
Merck

EHU086811

Sigma-Aldrich

MISSION® esiRNA

targeting human SYT1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
194,00 €
50 μG
343,00 €

194,00 €


Voraussichtliches Versanddatum20. April 2025



Größe auswählen

Ansicht ändern
20 μG
194,00 €
50 μG
343,00 €

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

194,00 €


Voraussichtliches Versanddatum20. April 2025


Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GCCCATATAGTGCTCTTTAGCCAGTATCTGTAAATACCTCAGTAATATGGGTCCTTTCATTTTTCCAGCCATGCATTCCTAACACAATTCAGTGGTACTTGGAATCCTGTTTTAATTTGCACAAATTTAAATGTAGAGAGCCCCTAAGTCCTTCATCATACCACTGCCCTCCAAATCTACTCTTCTTTTAAGCAATATGATGTGTAGATAGAGCATGAATGAAATTATTTATTGTATCACACTGTTGTATATACCAGTATGCTAAAGATTTATTTCTAGTTTGTGTATTTGTATGTTGTAAGCGTTTCCTAATCTGTGTATATCTAGATGTTTTTAATAAGATGTTCTATTTTAAACTATGTAAATTGACTGAGATATAGGAGAGCTGATAATATATTATACGGTAAATATAGTATCGTCTGCATTCCAGCA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Yang Xiao et al.
Biochimica et biophysica acta. Molecular basis of disease, 1864(5 Pt A), 1728-1743 (2018-02-25)
Diabetic cardiomyopathy is associated with suppressed autophagy and augmented inflammation in the heart. The effects of Tax1 binding protein 1 (TAX1BP1) on both autophagy and inflammation suggest that it may participate in the progression of diabetic cardiomyopathy. Mice were injected
Feng Xu et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 46(2), 699-712 (2018-04-06)
Necroptosis, a form of programmed necrosis, is involved in the pathologic process of several kinds of pulmonary diseases. However, the role of necroptosis in particulate matter (PM)-induced pulmonary injury remains unclear. The objective of this study is to investigate the
Changping Gu et al.
Shock (Augusta, Ga.), 44(1), 83-89 (2015-03-24)
Recombinant human annexin A5 (Anx5) is known to protect cardiac function during endotoxemia, although the underlying mechanisms have yet to be elucidated. In this study, we demonstrated that Anx5 could repair the disrupted cardiomyocyte adherens junctions and improve the myocardial
Hirokuni Akahori et al.
Nature communications, 6, 7792-7792 (2015-08-06)
Macrophages are an essential component of the immune response to ischaemic injury and play an important role in promoting inflammation and its resolution, which is necessary for tissue repair. The type I transmembrane glycoprotein CD163 is exclusively expressed on macrophages
Y Loriot et al.
Cell death & disease, 5, e1423-e1423 (2014-09-19)
Radiotherapy has a critical role in the treatment of small-cell lung cancer (SCLC). The effectiveness of radiation in SCLC remains limited as resistance results from defects in apoptosis. In the current study, we investigated whether using the Bcl-2/Bcl-XL inhibitor S44563

Fragen

Bewertungen

Kein Beurteilungswert

Aktive Filter

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.