Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EHU080541

Sigma-Aldrich

MISSION® esiRNA

targeting human TSPO

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GGCTTCACAGAGAAGGCTGTGGTTCCCCTGGGCCTCTACACTGGGCAGCTGGCCCTGAACTGGGCATGGCCCCCCATCTTCTTTGGTGCCCGACAAATGGGCTGGGCCTTGGTGGATCTCCTGCTGGTCAGTGGGGCGGCGGCAGCCACTACCGTGGCCTGGTACCAGGTGAGCCCGCTGGCCGCCCGCCTGCTCTACCCCTACCTGGCCTGGCTGGCCTTCACGACCACACTCAACTACTGCGTATGGCGGGACAACCATGGCTGGCGTGGGGGACGGCGGCTGCCAGAGTGAGTGCCCGGCCCACCAGGGACTGCAGCTGCACCAGCAGGTGCCATCACGCTTGTGATGTGGTGGCCGTCACGCTTTCATGACCACTGGGCCTGCTAGTCTGTCAGGGCCTT

Ensembl | Human Hinterlegungsnummer

ENSG00000100300

NCBI-Hinterlegungsnummer

NM_000714

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... TSPO(706) , TSPO(706)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Shanfei Ge et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 92, 942-951 (2017-06-18)
Growth Factor Receptor-bound 2 (GRB2) plays a crucial role in regulation of cellular function including proliferation and differentiation, and we previously identified GRB2 as promoting HSCs (HSCs) proliferation. However, the underlying mechanisms that are involving in the regulation of GRB2
Vladimir M Milenkovic et al.
International journal of molecular sciences, 20(13) (2019-07-22)
The 18 kDa translocator protein (TSPO) is an evolutionary conserved cholesterol binding protein localized in the outer mitochondrial membrane. It has been implicated in the regulation of various cellular processes including oxidative stress, proliferation, apoptosis, and steroid hormone biosynthesis. Since
Eleonora Da Pozzo et al.
International journal of molecular sciences, 20(18) (2019-09-13)
A key role of the mitochondrial Translocator Protein 18 KDa (TSPO) in neuroinflammation has been recently proposed. However, little is known about TSPO-activated pathways underlying the modulation of reactive microglia. In the present work, the TSPO activation was explored in
Stefanie Bader et al.
Psychoneuroendocrinology, 106, 65-76 (2019-04-08)
The translocator protein 18 kDa (TSPO), initially characterized as peripheral benzodiazepine receptor, is a conserved outer mitochondrial membrane protein, implicated in cholesterol transport thereby affecting steroid hormone biosynthesis, as well as in general mitochondrial function related to bioenergetics, oxidative stress, and
Jing Gong et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 39(19), 3752-3769 (2019-02-24)
Parkinson's disease is the second most common neurodegenerative disease, after Alzheimer's disease. Parkinson's disease is a movement disorder with characteristic motor features that arise due to the loss of dopaminergic neurons from the substantia nigra. Although symptomatic treatment by the
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.