Direkt zum Inhalt
Merck
Alle Fotos(1)

Wichtige Dokumente

EHU064831

Sigma-Aldrich

MISSION® esiRNA

targeting human IFT88

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
194,00 €
50 μG
343,00 €

194,00 €

Voraussichtliches Versanddatum15. April 2025

Alle Fotos(1)

Größe auswählen

Ansicht ändern
20 μG
194,00 €
50 μG
343,00 €

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

194,00 €

Voraussichtliches Versanddatum15. April 2025

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

100

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ATTATGAGAAGGCCGCTGAATTCTATAAAGAGGCTCTAAGAAATGATTCTTCTTGTACTGAAGCACTTTATAATATTGGCCTTACCTATGAGAAACTAAATCGGCTAGATGAGGCTTTGGACTGTTTCCTGAAACTTCACGCAATCCTACGAAACAGTGCCGAAGTTCTTTACCAGATAGCAAATATATATGAATTAATGGAAAATCCCAGTCAAGCTATTGAATGGCTAATGCAGGTGGTCAGTGTTATTCCAACCGATCCTCAAGTTTTATCTAAGCTAGGAGAATTATATGATCGTGAAGGAGATAAATCTCAAGCATTTCAATATTACTATGAGTCATATAGGTATTTTCCTTGTAATATTGAAGTCATTGAGTGGCTTGGAGCCTATTACATTGACACCCAATTTTGGGA

Ensembl | Human Hinterlegungsnummer

ENSG00000032742

NCBI-Hinterlegungsnummer

NM_175605

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... IFT88(8100) , IFT88(8100)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Dokumente section.

Wenn Sie Hilfe benötigen, wenden Sie sich bitte an Kundensupport

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Daolu Zhan et al.
Molecular medicine reports, 16(5), 6590-6599 (2017-09-14)
Intraflagellar transport protein 88 (IFT88) is protein crucial for the assembly and maintenance of primary cilia in chondrocytes. Primary cilia regulate mechanical and chemical signals in chondrocytes; however, the effects of cytokines on IFT88 expression and cilia formation and maintenance
Taylor M Goldsmith et al.
Cell and tissue research, 380(1), 191-200 (2020-01-05)
Most mammalian cells possess a single, non-motile primary cilium that plays an important role in mediating cellular signaling pathways, such as Hedgehog (Hh) signaling. Primary cilia are present on testicular somatic cells and demonstrate a temporal expression during development; however
Yan-Hui Li et al.
Journal of cellular physiology, 236(6), 4764-4777 (2020-12-05)
Primary cilia have been found to function as mechanosensors in low-magnitude high-frequency vibration (LMHFV)-induced osteogenesis. The PGE2 also regulates bone homeostasis and mechanical osteogenesis through its receptor EP4 signaling, but its involvement in LMHFV-induced or in primary cilia-induced osteogenesis has
Qike Huang et al.
Cancer letters, 402, 52-60 (2017-05-26)
Determining the origin of liver cancer stem cells is important for treating hepatocellular carcinoma. Tg737 deficiency plays an important role in the malignant transformation of liver stem cells, but the underlying mechanism remains unclear. Here we established a chemical-induced mouse
Matthew E Deren et al.
International journal of molecular sciences, 17(2), 188-188 (2016-02-11)
Chondroprogenitors and hypertrophic chondrocytes, which are the first and last stages of the chondrocyte differentiation process, respectively, are sensitive to mechanical signals. We hypothesize that the mechanical sensitivity of these cells depends on the cell surface primary cilia. To test
Alle zugehörigen Dokumente anzeigen

Fragen

Bewertungen

Kein Beurteilungswert

Aktive Filter

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.