Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU058001

Sigma-Aldrich

MISSION® esiRNA

targeting human CLU

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GACTCTGCTGCTGTTTGTGGGGCTGCTGCTGACCTGGGAGAGTGGGCAGGTCCTGGGGGACCAGACGGTCTCAGACAATGAGCTCCAGGAAATGTCCAATCAGGGAAGTAAGTACGTCAATAAGGAAATTCAAAATGCTGTCAACGGGGTGAAACAGATAAAGACTCTCATAGAAAAAACAAACGAAGAGCGCAAGACACTGCTCAGCAACCTAGAAGAAGCCAAGAAGAAGAAAGAGGATGCCCTAAATGAGACCAGGGAATCAGAGACAAAGCTGAAGGAGCTCCCAGGAGTGTGCAATGAGACCATGATGGCCCTCTGGGAAGAGTGTAAGCCCTGCCTGAAACAGACCTGCATGAAGTTCTACGCACGCGTCTGCAGAAGTGGCTCAGGCCTGGTTGGCCGCCAGCTTGAGGAGTTCCTGAACCAGAGCTCGCCCTTCTAC

Ensembl | Human Hinterlegungsnummer

ENSG00000120885

NCBI-Hinterlegungsnummer

NM_001831

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... CLU(1191) , CLU(1191)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Lihua Mu et al.
Bioengineered, 11(1), 472-483 (2020-04-07)
Recent focus has turned to secretory clusterin (sCLU) as a key contributor to chemoresistance of anticancer agents, but the role of sCLU on chemotherapy drug response to gastric cancer cells is not fully understood. Previous research found that sCLU was
Na Fu et al.
Life sciences, 256, 117911-117911 (2020-06-07)
To explore the potential regulatory mechanism of differentially expressed mRNAs in Hepatitis C virus (HCV)-related hepatocellular carcinoma (HCC). Patients with HCV-related HCC and age- and gender-matched healthy subjects were enrolled. Differentially expressed mRNAs in the plasma were detected by digital
Xiaohui Wang et al.
Current pharmaceutical biotechnology, 21(2), 131-139 (2019-08-23)
The aim of the study was to investigate the expression of sCLU in relation to the clinicopathological features and prognosis of patients with untreated High-Grade Osteosarcoma (HGOS) and to evaluate sCLU as a target for osteosarcoma (OS) therapies. The expression
Chiara Tarquini et al.
Aging, 12(11), 10129-10146 (2020-06-10)
Osteoarthritis (OA) is the most common joint disease characterized by destruction of articular cartilage. OA-induced cartilage degeneration causes inflammation, oxidative stress and the hypertrophic shift of quiescent chondrocytes. Clusterin (CLU) is a ubiquitous glycoprotein implicated in many cellular processes and
Alice Filippini et al.
Glia, 69(3), 681-696 (2020-10-13)
The progressive neuropathological damage seen in Parkinson's disease (PD) is thought to be related to the spreading of aggregated forms of α-synuclein. Clearance of extracellular α-synuclein released by degenerating neurons may be therefore a key mechanism to control the concentration
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.