Direkt zum Inhalt
Merck
Alle Fotos(1)

Wichtige Dokumente

EHU046211

Sigma-Aldrich

MISSION® esiRNA

targeting human KIF2C

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
194,00 €
50 μG
343,00 €

194,00 €

Voraussichtliches Versanddatum27. Mai 2025

Alle Fotos(1)

Größe auswählen

Ansicht ändern
20 μG
194,00 €
50 μG
343,00 €

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

194,00 €

Voraussichtliches Versanddatum27. Mai 2025

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TTTCGGGCTACTTTGGAATGTCATCCACTTACTATGACTGATCCTATCGAAGAGCACAGAATATGTGTCTGTGTTAGGAAACGCCCACTGAATAAGCAAGAATTGGCCAAGAAAGAAATTGATGTGATTTCCATTCCTAGCAAGTGTCTCCTCTTGGTACATGAACCCAAGTTGAAAGTGGACTTAACAAAGTATCTGGAGAACCAAGCATTCTGCTTTGACTTTGCATTTGATGAAACAGCTTCGAATGAAGTTGTCTACAGGTTCACAGCAAGGCCACTGGTACAGACAATCTTTGAAGGTGGAAAAGCAACTTGTTTTGCATATGGCCAGACAGGAAGTGGCAAGACACATACTATGGGCGGAGACCTCTCTGGGAAAGCCCAGAATGCATCCAAAGGGAT

Ensembl | Human Hinterlegungsnummer

ENSG00000142945

NCBI-Hinterlegungsnummer

NM_006845

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... KIF2C(11004) , KIF2C(11004)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number
QCS

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Suche nach COA

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Haibo Wang et al.
Oncotarget, 8(30), 48671-48687 (2017-04-19)
Defects in resolving kinetochore-microtubule attachment mistakes during mitosis is linked to chromosome instability associated with carcinogenesis as well as resistance to cancer therapy. Here we report for the first time that tumor suppressor p53-binding protein 1 (53BP1) is phosphorylated at
Ashley Mooneyham et al.
Molecular cancer research : MCR, 17(2), 370-383 (2018-10-17)
UNC-45A, a highly conserved member of the UCS (UNC45A/CRO1/SHE4P) protein family of cochaperones, plays an important role in regulating cytoskeletal-associated functions in invertebrates and mammalian cells, including cytokinesis, exocytosis, cell motility, and neuronal development. Here, for the first time, UNC-45A
Rui-Chao Chai et al.
Carcinogenesis, 40(10), 1229-1239 (2019-06-04)
1p/19q codeletion, which leads to the abnormal expression of 1p19q genes in oligodendroglioma, is associated with chemosensitivity and favorable prognosis. Here, we aimed to explore the clinical implications of 1p19q gene expression in 1p/19q non-codel gliomas. We analyzed expression of
Chenyu Li et al.
Scientific reports, 6, 18773-18773 (2016-01-07)
Nucleolar and spindle-associated protein (NuSAP) is a microtubule-associated protein that functions as a microtubule stabiliser. Depletion of NuSAP leads to severe mitotic defects, however the mechanism by which NuSAP regulates mitosis remains elusive. In this study, we identify the microtubule
Jonathan W Armond et al.
Journal of cell science, 128(10), 1991-2001 (2015-04-25)
Kinetochores regulate the dynamics of attached microtubule bundles (kinetochore-fibres, K-fibres) to generate the forces necessary for chromosome movements in mitosis. Current models suggest that poleward-moving kinetochores are attached to depolymerising K-fibres and anti-poleward-moving kinetochores to polymerising K-fibres. How the dynamics
Alle zugehörigen Dokumente anzeigen

Fragen

Bewertungen

Kein Beurteilungswert

Aktive Filter

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.