Direkt zum Inhalt
Merck

EHU030431

Sigma-Aldrich

MISSION® esiRNA

targeting human SNAI1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
194,00 €
50 μG
343,00 €

194,00 €


Voraussichtliches Versanddatum02. Juni 2025



Größe auswählen

Ansicht ändern
20 μG
194,00 €
50 μG
343,00 €

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

194,00 €


Voraussichtliches Versanddatum02. Juni 2025


Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TTTACCTTCCAGCAGCCCTACGACCAGGCCCACCTGCTGGCAGCCATCCCACCTCCGGAGATCCTCAACCCCACCGCCTCGCTGCCAATGCTCATCTGGGACTCTGTCCTGGCGCCCCAAGCCCAGCCAATTGCCTGGGCCTCCCTTCGGCTCCAGGAGAGTCCCAGGGTGGCAGAGCTGACCTCCCTGTCAGATGAGGACAGTGGGAAAGGCTCCCAGCCCCCCAGCCCACCCTCACCGGCTCCTTCGTCCTTCTCCTCTACTTCAGTCTCTTCCTTGGAGGCCGAGGCCTATGCTGCCTTCCCAGGCTTGGGCCAAGTGCCCAAGCAGCTGGCCCAGCTCTCTGAGGCCAAGGATCTCCAGGCTCGAAAGGCCTTCAACTGCAAATACTGCAACAAGGAATACCTCAGCCTGG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Hong Li et al.
Theranostics, 9(7), 1909-1922 (2019-05-01)
Rationale: Glioblastoma (GBM) is the most common and aggressive brain tumor, characterized by its propensity to invade the surrounding brain parenchyma. The effect of extracellular high-mobility group box 1 (HMGB1) protein on glioblastoma (GBM) progression is still controversial. p62 is
Yu-Yi Liu et al.
Scientific reports, 7(1), 2461-2461 (2017-05-28)
We previously performed long non-coding RNA (lncRNA) expression microarray analyses to identify novel indicators for gastric cancer (GC) metastasis and prognosis in which we identified lncRNA XLOC_010235 (XLOC) as a candidate RNA. However, XLOC_010235 molecular mechanism of action remains unclear.
Dong Yeon Kim et al.
Oncotarget, 8(63), 106190-106205 (2018-01-02)
Renal tubulointerstitial fibrosis is an important event in the pathogenesis of diabetic nephropathy. Under pathologic conditions, renal tubular epithelial cells undergo transition characterized by loss of cell-cell adhesion and increased cell migration. This study investigated that eucalyptol inhibited tubular epithelial
Elsa M Reyes-Reyes et al.
Oncotarget, 8(61), 103828-103842 (2017-12-22)
Although several lines of evidence have established the central role of epithelial-to-mesenchymal-transition (EMT) in malignant progression of non-small cell lung cancers (NSCLCs), the molecular events connecting EMT to malignancy remain poorly understood. This study presents evidence that Long Interspersed Nuclear
Atsuhiro Kanda et al.
Scientific reports, 9(1), 673-673 (2019-01-27)
The epithelial-mesenchymal transition (EMT) is a key process in fibrogenic diseases where transdifferentiated myofibroblasts produce excessive amounts of extracellular matrix, resulting in organ dysfunction. Idiopathic epiretinal membrane (iERM) is a vision-threatening disorder characterized by fibrocellular proliferation and contraction on the

Fragen

Bewertungen

Kein Beurteilungswert

Aktive Filter

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.