Direkt zum Inhalt
Merck

EHU027961

Sigma-Aldrich

MISSION® esiRNA

targeting human LRP6

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
194,00 €
50 μG
343,00 €

194,00 €


Check Cart for Availability


Größe auswählen

Ansicht ändern
20 μG
194,00 €
50 μG
343,00 €

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

194,00 €


Check Cart for Availability

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCCATGCACCTGGTTCTACTTCAAGATGAGCTATCATGTGGAGAACCTCCAACATGTTCTCCTCAGCAGTTTACTTGTTTCACGGGGGAAATTGACTGTATCCCTGTGGCTTGGCGGTGCGATGGGTTTACTGAATGTGAAGACCACAGTGATGAACTCAATTGTCCTGTATGCTCAGAGTCCCAGTTCCAGTGTGCCAGTGGGCAGTGTATTGATGGTGCCCTCCGATGCAATGGAGATGCAAACTGCCAGGACAAATCAGATGAGAAGAACTGTGAAGTGCTTTGTTTAATTGATCAGTTCCGCTGTGCCAATGGTCAGTGCATTGGAAAGCACAAGAAGTGTGATCATAATGTGGATTGCAGTGACAAGTCAGATGAACTGGATTGTTATCCGACTGAAGAACCAGCACCACAG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Xu Luo et al.
Neuroscience bulletin, 36(10), 1171-1181 (2020-06-21)
Neuronal apoptosis is one of the essential mechanisms of early brain injury after subarachnoid hemorrhage (SAH). Recently, HLY78 has been shown to inhibit apoptosis in tumor cells and embryonic cells caused by carbon ion radiation through activation of the Wnt/β-catenin
Yaqi Qiu et al.
Cell and tissue research, 383(3), 1077-1092 (2020-11-28)
Bile salt-dependent lipase (BSDL) within intestinal lumen can be endocytosed by enterocytes and support the intestinal barrier function. However, the epithelial-supporting effect of this protein has not been verified in a human cell line and neither the direct signaling pathway
Xu Luo et al.
Brain research bulletin, 162, 107-114 (2020-06-23)
Wnt/β-catenin signaling plays an essential role in blood-brain barrier (BBB) formation and maintenance under pathophysiological conditions. HLY78, a lycorine derivative, has been identified as a novel activator of Wnt/β-catenin signaling in vitro. However, the effects of HLY78 on the BBB
Antonia Franziska Eckert et al.
eLife, 9 (2020-05-23)
Development and homeostasis of multicellular organisms is largely controlled by complex cell-cell signaling networks that rely on specific binding of secreted ligands to cell surface receptors. The Wnt signaling network, as an example, involves multiple ligands and receptors to elicit
Lei Wang et al.
Bone research, 6, 22-22 (2018-07-25)
Low-density lipoprotein receptor-related protein 6 (LRP6) is a co-receptor for Wnt signaling and can be recruited by multiple growth factors/hormones to their receptors facilitating intracellular signaling activation. The ligands that bind directly to LRP6 have not been identified. Here, we

Fragen

Bewertungen

Kein Beurteilungswert

Aktive Filter

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.