Direkt zum Inhalt
Merck

EHU025951

Sigma-Aldrich

MISSION® esiRNA

targeting human AR

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
194,00 €
50 μG
343,00 €

194,00 €


Check Cart for Availability


Größe auswählen

Ansicht ändern
20 μG
194,00 €
50 μG
343,00 €

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

194,00 €


Check Cart for Availability

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GTGGAAGCTGCAAGGTCTTCTTCAAAAGAGCCGCTGAAGGGAAACAGAAGTACCTGTGCGCCAGCAGAAATGATTGCACTATTGATAAATTCCGAAGGAAAAATTGTCCATCTTGTCGTCTTCGGAAATGTTATGAAGCAGGGATGACTCTGGGAGCCCGGAAGCTGAAGAAACTTGGTAATCTGAAACTACAGGAGGAAGGAGAGGCTTCCAGCACCACCAGCCCCACTGAGGAGACAACCCAGAAGCTGACAGTGTCACACATTGAAGGCTATGAATGTCAGCCCATCTTTCTGAATGTCCTGGAAGCCATTGAGCCAGGTGTAGTGTGTGCTGGACACGACAACAACCAGCCCGACTCCTTTGCAGCCTTGCTCTCTAGCCTCAATGAACTGGGAGAGAGACAGCTTGTACACGTGGTCAAGTGGGCCAAGGCCTTGCCTGGCTTCCGCAACTTACACGTGGACGACCAGATGGCTGTCATTCA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... AR(367) , AR(367)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Chenfei Wang et al.
Nature cell biology, 20(5), 620-631 (2018-04-25)
H3K9me3-dependent heterochromatin is a major barrier of cell fate changes that must be reprogrammed after fertilization. However, the molecular details of these events are lacking in early embryos. Here, we map the genome-wide distribution of H3K9me3 modifications in mouse early
Sekar Natesampillai et al.
Journal of immunology (Baltimore, Md. : 1950), 203(3), 718-724 (2019-06-14)
CD4 T cells from HIV-1 infected patients die at excessive rates compared to those from uninfected patients, causing immunodeficiency. We previously identified a dominant negative ligand that antagonizes the TRAIL-dependent pathway of cell death, which we called TRAILshort. Because the
Nathan R Zemke et al.
Cell host & microbe, 22(6), 789-800 (2017-12-15)
The N-terminal half of adenovirus e1a assembles multimeric complexes with host proteins that repress innate immune responses and force host cells into S-phase. In contrast, the functions of e1a's C-terminal interactions with FOXK, DCAF7, and CtBP are unknown. We found
Madison Schank et al.
Cell death & disease, 11(12), 1030-1030 (2020-12-04)
Telomere erosion and mitochondrial dysfunction are prominent features of aging cells with progressive declines of cellular functions. Whether telomere injury induces mitochondrial dysfunction in human T lymphocytes, the major component of adaptive host immunity against infection and malignancy, remains unclear.
Vasileios Chortis et al.
Endocrinology, 159(8), 2836-2849 (2018-06-01)
Adrenocortical carcinoma (ACC) is an aggressive malignancy with poor response to chemotherapy. In this study, we evaluated a potential new treatment target for ACC, focusing on the mitochondrial reduced form of NAD phosphate (NADPH) generator nicotinamide nucleotide transhydrogenase (NNT). NNT

Fragen

Bewertungen

Kein Beurteilungswert

Aktive Filter

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.