Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU090501

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nsg1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGGTGTCACCGAGAGGTTTAAGGTCTCCGTGCTGGTCCTCTTTGCCCTGGCCTTCCTCACCTGTGTCGTCTTCCTGGTTGTCTACAAAGTGTACAAGTATGACCGCGCCTGCCCTGATGGGTTTGTCTTGAAGAACACCCAGTGCATCCCAGAAGGCTTGGAGAGCTACTACACGGAGCAAGACTCCAGTGCCCGGGAGAAATTTTACACTGTCATAAACCACTACAACGTGGCCAAGCAGAGCATCACCCGCTCCGTGTCGCCATGGATGTCAGTTCTGTCAGAAGAGAAGCTGTCGGAACAGGAGACCGAAGCTGCAGAGAAGTCAGCTTAGCGAGCAGGGCAGGTTCCTTACGATGTGTCACTTGAAGGCAACAAGGGGACTTTGAGGGACATTTCATTAAATATAATTACCGATAATTTAGAGATTACTCATTTACGGTGCAATTGCTTCTGTTTGCTAATGCTGCTTTGCAAATTAAACTTGCTGCGGACCACCCACAGGCGTAAGAACAAGAGCATCTCAGCATTGCTTAGAGAGCTGGATGCCACTGTCCACGCTGAGGAGTCTTC

Ensembl | nº de acceso | ratón

ENSMUSG00000029126

Nº de acceso NCBI

NM_010942

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... NSG1(18196) , Nsg1(18196)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Purusottam Mohapatra et al.
The international journal of biochemistry & cell biology, 66, 75-84 (2015-07-28)
Combination therapy using two or more small molecule inhibitors of aberrant signaling cascade in aggressive breast cancers is a promising therapeutic strategy over traditional monotherapeutic approaches. Here, we have studied the synergistic mechanism of resveratrol and curcumin induced apoptosis using
Daqian Wan et al.
Anti-cancer drugs, 26(9), 931-941 (2015-07-17)
Aspidin PB is a natural product extracted from Dryopteris fragrans (L.) Schott, which has been characterized for its various biological activities. We reported that aspidin PB induced cell cycle arrest and apoptosis through the p53/p21 and mitochondria-dependent pathways in human
Koichi Shoji et al.
Oncology reports, 32(1), 65-70 (2014-05-21)
Fibroblast growth factor receptor 2 (FGFR2) is thought to mediate an important signaling pathway between prostate epithelial cells and stromal cells for maintenance of homeostasis in normal prostate tissue. Abnormalities of FGFR2 have been shown in advanced prostate cancer or
Haizhi Huang et al.
Journal of functional foods, 15, 464-475 (2015-06-27)
Galangin and myricetin are flavonoids isolated from vegetables and fruits which exhibit anti-proliferative activity in human cancer cells. In this study, their anti-angiogenic effects were investigated with
Z Shi et al.
Oncogene, 34(19), 2538-2545 (2014-07-01)
The cyclin-dependent kinase (CDK) inhibitor 1A, p21/Cip1, is a vital cell cycle regulator, dysregulation of which has been associated with a large number of human malignancies. One critical mechanism that controls p21 function is through its degradation, which allows the
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico