Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU088711

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Atp11c

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTGAAAATGCAAAGCGAGTGAGGAAAGAAAGTGAAAAAATCAAGGTTGGTGATGTAGTAGAAGTACAGGCAAATGAAACCTTTCCCTGTGATCTTATACTTCTGTCATCCTGCACAACTGATGGAACCTGTTATGTCACTACAGCCAGTCTTGATGGTGAATCTAATTGCAAGACACATTATGCAGTACGAGATACCATTGCACTGTGTACAGCCGAATCCATTGATAATCTCCGAGCAACAATTGAATGTGAGCAGCCTCAACCTGATCTCTACAGGTTTGTTGGGCGAATCAGTATCTATAGTAATAGTATTGAGGCTGTTGCCAGGTCTTTGGGACCTGAAAATCTTTTGCTGAAAGGAGCCACACTTAAAAATACCAAGAAGATATATGGAGTTGCTGTTTACACTGGGATGGAAACCAAAATGGCTTTGAACTACCAAGGGAAATCTCAGAAATGTTCTGCTGTTGAAAAATCTATTAATGCCTTCTTGATTGTTTATTTATTTATCTTACTGACCAAAGCTGCAGTATGCA

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Paweł Jóźwiak et al.
Nutrition and cancer, 67(8), 1333-1341 (2015-09-19)
Enhanced glucose requirement of cancer cells is associated with an increased glucose transport across plasma membrane that is mediated by a family of facilitated glucose transporter proteins, named GLUTs. GLUT1 is the main transporter in thyroid cancer cells. Glucose is
Chong-Shan Shi et al.
Journal of immunology (Baltimore, Md. : 1950), 193(6), 3080-3089 (2014-08-20)
Coronaviruses (CoV) have recently emerged as potentially serious pathogens that can cause significant human morbidity and death. The severe acute respiratory syndrome (SARS)-CoV was identified as the etiologic agent of the 2002-2003 international SARS outbreak. Yet, how SARS evades innate
Taryn E Travis et al.
Journal of burn care & research : official publication of the American Burn Association, 36(3), e125-e135 (2014-07-23)
The duroc pig has been described as a promising animal model for use in the study of human wound healing and scar formation. However, little is known about the presence and chronology of the fibrocyte cell population in the healing
Michael Moldavan et al.
The European journal of neuroscience, 42(12), 3018-3032 (2015-09-24)
GABA is a principal neurotransmitter in the suprachiasmatic hypothalamic nucleus (SCN), the master circadian clock. Despite the importance of GABA and GABA uptake for functioning of the circadian pacemaker, the localization and expression of GABA transporters (GATs) in the SCN
Edith Suzarte et al.
International immunology, 27(8), 367-379 (2015-03-22)
Our group developed a subunit vaccine candidate against dengue virus based on two different viral regions: the domain III of the envelope protein and the capsid protein. The novel chimeric protein from dengue-2 virus [domain III-capsid (DIIIC-2)], when presented as

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico