Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU071731

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mta1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGCCAAAGTGGTGTGTTTCTACAGAAGGCGGGACATTTCCAGCAGCCTCATCGCGCTGGCGGACAAGCATGCAAGGGAAGTGGAGGAGGAGGTAGAAAACCCAGAGATGGTGGACCTGCCTGAGAAACTTAAGCATCAGCTGCGGCATCGAGAACTGTTCCTGTCTCGGCAGTTGGAGTCTCTGCCTGCCACCCACATCAGGGGCAAGTGCAGTGTTACCCTGCTCAATGAGACGGAGTCACTCAAGTCCTACTTGGAGCGTGAGGATTTCTTCTTCTACTCTCTAGTCTACGACCCACAGCAGAAGACCCTCCTGGCTGATAAAGGGGAAATTCGTGTAGGAAACCGGTACCAGGCTGACATCACTGACTTGCTGAAAGAAGGTGAGGAGGACGGCCGCGATCAGTCAAAACTGGAGACCAAGGTGTGG

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

12 - Non Combustible Liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Wenhao Weng et al.
International journal of oncology, 44(3), 812-818 (2014-01-16)
Esophageal squamous cell carcinoma (ESCC) is one of the most common malignant tumors. Upregulation of metastasis-associated protein 1 (MTA1) has been reported to contribute to the development of esophageal squamous cell carcinoma. Therefore, the objective of our study was to identify
Hong Zhang et al.
Acta biochimica et biophysica Sinica, 47(7), 496-503 (2015-05-23)
Metastasis-associated gene 1 (MTA1) is associated with cell growth, metastasis, and survival in non-small-cell lung cancer (NSCLC). Several previous reports have demonstrated that microRNAs affect gene expression through interaction between their seed region and the 3'-untranslated region of the target

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico