Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU158451

Sigma-Aldrich

MISSION® esiRNA

targeting human DNMT3B

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCGACAGCTCTCCAATACTCAGGTTAATGCTGAAAAATCATCCAAGACAGTTATTGCAAGAGTTTAATTTTTGAAAACTGGCTACTGCTCTGTGTTTACAGACGTGTGCAGTTGTAGGCATGTAGCTACAGGACATTTTTAAGGGCCCAGGATCGTTTTTTCCCAGGGCAAGCAGAAGAGAAAATGTTGTATATGTCTTTTACCCGGCACATTCCCCTTGCCTAAATACAAGGGCTGGAGTCTGCACGGGACCTATTAGAGTATTTTCCACAATGATGATGATTTCAGCAGGGATGACGTCATCATCACATTCAGGGCTATTTTTTCCCCCACAAACCCAAGGGCAGGGGCCACTCTTAGCTAAATCCCTCCCCGTGACTGCAATAGAACCCTCTGGGGAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yue Zhou et al.
American journal of translational research, 11(3), 1736-1747 (2019-04-12)
Temporomandibular joint (TMJ) arthritis causes severe debilitation and has few treatment options. Here, we found a small molecule, DNA methyltransferase 3B (Dnmt3b), as a putative therapeutic target, partially rescued osteoarthritic phenotype. Dnmt3b was detected differentially expressed in cell zones of
Hiroaki Fujimori et al.
Scientific reports, 5, 18231-18231 (2015-12-17)
A comprehensive genome-wide screen of radiosensitization targets in HeLa cells was performed using a shRNA-library/functional cluster analysis and DNMT3B was identified as a candidate target. DNMT3B RNAi increased the sensitivity of HeLa, A549 and HCT116 cells to both γ-irradiation and
Chelsea R McCoy et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 39(16), 3144-3158 (2019-01-27)
There is growing evidence of abnormal epigenetic processes playing a role in the neurobiology of psychiatric disorders, although the precise nature of these anomalies remains largely unknown. To study neurobiological (including epigenetic) factors that influence emotionality, we use rats bred
Xin Yue et al.
Virology journal, 8, 118-118 (2011-03-16)
The hepatitis B virus (HBV) is a major etiological factor of inflammation and damage to the liver resulting in hepatocellular carcinoma. Transcription factors play important roles in the disordered gene expression and liver injury caused by HBV. However, the molecular
Yue Teng et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 39(6), 2341-2352 (2016-11-11)
Epigenetic abnormalities are increasingly observed in multiple malignancies, including epithelial ovarian cancer (EOC), and their effects can be significantly counteracted by tumor-suppressor microRNAs, namely epi-miRNAs. Here, we investigated the role of miR-29b, a well-established epi-miRNA, in the DNA methylation regulation

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico