Saltar al contenido
Merck
Todas las fotos(2)

Documentos clave

EHU114431

Sigma-Aldrich

MISSION® esiRNA

targeting human KRAS

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGCCTGCTGAAAATGACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGTGCCTTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCAACAATAGAGGATTCCTACAGGAAGCAAGTAGTAATTGATGGAGAAACCTGTCTCTTGGATATTCTCGACACAGCAGGTCAAGAGGAGTACAGTGCAATGAGGGACCAGTACATGAGGACTGGGGAGGGCTTTCTTTGTGTATTTGCCATAAATAATACTAAATCATTTGAAGATATTCACCATTATAGAGAACAAATTAAAAGAGTTAAGGACTCTGAAGATGTACCTATGGTCCTAGTAGGAAATAAATGTGATTTGCCTTCTAGAACAGTAGACACAAAACAGGCTCAGGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Clinically Viable Gene Expression Assays with Potential for Predicting Benefit from MEK Inhibitors.
Roz Brant et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 23(6), 1471-1480 (2016-10-14)
Qian Fan et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 44(4), 1311-1324 (2017-11-29)
MicroRNAs (miRNAs) have emerged as major regulators of tumour development and progression in non-small cell lung cancer (NSCLC). However, the role of miR-193a-3p in NSCLC is still unclear. Quantitative RT-PCR was used to detect miR-193a-3p expression levels in NSCLC tumour
Ping-Chih Hsu et al.
Journal of cellular and molecular medicine, 22(6), 3073-3085 (2018-03-27)
Yes-associated protein (YAP) is a main mediator of the Hippo pathway and promotes cancer development and progression in human lung cancer. We sought to determine whether inhibition of YAP suppresses metastasis of human lung adenocarcinoma in a murine model. We
Xinquan Liu et al.
International journal of nanomedicine, 14, 6589-6600 (2019-09-10)
The RAS family of oncogenes (KRAS, HRAS, NRAS) are the most frequent mutations in cancers and regulate key signaling pathways that drive tumor progression. As a result, drug delivery targeting RAS-driven tumors has been a long-standing challenge in cancer therapy.
Stella Liong et al.
Mediators of inflammation, 2018, 3645386-3645386 (2018-11-08)
Heightened placental inflammation and dysfunction are commonly associated in pregnant obese women compared to their pregnant lean counterparts. The small GTPase superfamily members known as the rat sarcoma viral oncogene homolog (Ras) proteins, in particular, the K-Ras and H-Ras isoforms

Artículos

Quantitative and qualitative western blotting to validate knockdown by esiRNA.

Quantitative and qualitative western blotting to validate knockdown by esiRNA.

Quantitative and qualitative western blotting to validate knockdown by esiRNA.

Quantitative and qualitative western blotting to validate knockdown by esiRNA.

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico