Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU109121

Sigma-Aldrich

MISSION® esiRNA

targeting human GBA

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGCCCATGTTCTACCACCTTGGCCACTTCAGCAAGTTCATTCCTGAGGGCTCCCAGAGAGTGGGGCTGGTTGCCAGTCAGAAGAACGACCTGGACGCAGTGGCACTGATGCATCCCGATGGCTCTGCTGTTGTGGTCGTGCTAAACCGCTCCTCTAAGGATGTGCCTCTTACCATCAAGGATCCTGCTGTGGGCTTCCTGGAGACAATCTCACCTGGCTACTCCATTCACACCTACCTGTGGCGTCGCCAGTGATGGAGCAGATACTCAAGGAGGCACTGGGCTCAGCCTGGGCATTAAAGGGACAGAGTCAGCTCACACGCTGTCTGTGACTAAAGAGGGCACAGCAGGGCCAGTGTGAGCTTACAGCGACGTAAGCCCAGGGGCAATGGTTTGGGTGACTCACTTTCCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Tiziana Squillaro et al.
Journal of cellular physiology, 232(12), 3454-3467 (2017-01-18)
Lysosomal storage disorders (LDS) comprise a group of rare multisystemic diseases resulting from inherited gene mutations that impair lysosomal homeostasis. The most common LSDs, Gaucher disease (GD), and Fabry disease (FD) are caused by deficiencies in the lysosomal glucocerebrosidase (GBA)
Kecheng Zhou et al.
The American journal of pathology, 190(10), 2018-2028 (2020-07-18)
Studies of lysosome associated protein transmembrane 4B (LAPTM4B) have mainly focused on the 35-kDa isoform and its association with poor prognosis in cancers. Here, by employing a novel monoclonal antibody, the authors found that the 24-kDa LAPTM4B isoform predominated in
Jong-Won Lim et al.
Human molecular genetics, 24(17), 4817-4828 (2015-06-05)
Facioscapulohumeral muscular dystrophy (FSHD) is caused by the aberrant expression of the DUX4 transcription factor in skeletal muscle. The DUX4 retrogene is encoded in the D4Z4 macrosatellite repeat array, and smaller array size or a mutation in the SMCHD1 gene

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico