Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU096311

Sigma-Aldrich

MISSION® esiRNA

targeting human BRCA1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTTCCCTGCTTCCAACACTTGTTATTTGGTAAAGTAAACAATATACCTTCTCAGTCTACTAGGCATAGCACCGTTGCTACCGAGTGTCTGTCTAAGAACACAGAGGAGAATTTATTATCATTGAAGAATAGCTTAAATGACTGCAGTAACCAGGTAATATTGGCAAAGGCATCTCAGGAACATCACCTTAGTGAGGAAACAAAATGTTCTGCTAGCTTGTTTTCTTCACAGTGCAGTGAATTGGAAGACTTGACTGCAAATACAAACACCCAGGATCCTTTCTTGATTGGTTCTTCCAAACAAATGAGGCATCAGTCTGAAAGCCAGGGAGTTG

Ensembl | human accession no.

ENSG00000012048

NCBI accession no.

NM_007294

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... BRCA1(672) , BRCA1(672)

Categorías relacionadas

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Wenchao Ji et al.
Biochemical and biophysical research communications, 522(1), 121-126 (2019-11-23)
Lung cancer is the leading cause of cancer death worldwide. PARP inhibitors have become a new line of cancer therapy and a successful demonstration of the synthetic lethality concept. The mechanism and efficacy of PARP inhibitors have been well studied
Eliana Mc Tacconi et al.
EMBO molecular medicine, 9(10), 1398-1414 (2017-07-22)
Maintenance of genome integrity requires the functional interplay between Fanconi anemia (FA) and homologous recombination (HR) repair pathways. Endogenous acetaldehyde, a product of cellular metabolism, is a potent source of DNA damage, particularly toxic to cells and mice lacking the
Oreekha Amin et al.
BMC cancer, 15, 817-817 (2015-10-30)
Impairment of homologous recombination (HR) is found in close to 50 % of ovarian and breast cancer. Tumors with BRCA1 mutations show increased expression of the Insulin-like growth factor type 1 receptor (IGF-1R). We previously have shown that inhibition of
Nadire Duru et al.
Cancer letters, 369(1), 184-191 (2015-08-25)
Breast and lung cancer patients who are treated with radiotherapy often have severe side effects, including radiation-induced lung damage and secondary cancers. Activation of the NRF2 pathway is a well-known mechanism that protects cells against radiation induced oxidative stress, but
Parker L Sulkowski et al.
Nature genetics, 50(8), 1086-1092 (2018-07-18)
The hereditary cancer syndromes hereditary leiomyomatosis and renal cell cancer (HLRCC) and succinate dehydrogenase-related hereditary paraganglioma and pheochromocytoma (SDH PGL/PCC) are linked to germline loss-of-function mutations in genes encoding the Krebs cycle enzymes fumarate hydratase and succinate dehydrogenase, thus leading
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico