Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU076751

Sigma-Aldrich

MISSION® esiRNA

targeting human BRD4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CAACCCTAACAAGCCCAAGAGGCAGACCAACCAACTGCAATACCTGCTCAGAGTGGTGCTCAAGACACTATGGAAACACCAGTTTGCATGGCCTTTCCAGCAGCCTGTGGATGCCGTCAAGCTGAACCTCCCTGATTACTATAAGATCATTAAAACGCCTATGGATATGGGAACAATAAAGAAGCGCTTGGAAAACAACTATTACTGGAATGCTCAGGAATGTATCCAGGACTTCAACACTATGTTTACAAATTGTTACATCTACAACAAGCCTGGAGATGACATAGTCTTAATGGCAGAAGCTCTGGAAAAGCTCTTCTTGCAAAAAATAAATGAGCTACCCACAGAAGAAACCGAGATCATGATAGTCCAGGCAAAAGGAAGAGGACGTGGGAGGAAAGAAACA

Ensembl | nº de acceso humano

ENSG00000141867

Nº de acceso NCBI

NM_058243

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... BRD4(23476) , BRD4(23476)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
UDV
JUU
QCS
ZUT
TTS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Stella Liong et al.
Reproduction (Cambridge, England), 155(6), 573-582 (2018-05-12)
Preeclampsia affects 5% of all pregnancies and is a serious disorder of pregnancy, characterised by high maternal blood pressure, placental hypoxia, fluid retention (oedema) and proteinuria. Women with preeclampsia are associated with exaggerated levels of pro-inflammatory cytokines, chemokines and anti-angiogenic
Xuanchen Zhou et al.
Frontiers in medicine, 7, 413-413 (2020-09-15)
Objectives: This study aimed to explore the relationship between bromodomain-containing protein 4 (BRD4), epithelial-mesenchymal transition (EMT), and disease severity in chronic rhinosinusitis with nasal polyps (CRSwNP). Methods: We performed immunofluorescent (IF) staining to evaluate the expression of BRD4 in the
Sushmita Mustafi et al.
EBioMedicine, 43, 201-210 (2019-04-13)
Bromodomain and extra-terminal inhibitors (BETi) have shown efficacy for the treatment of aggressive triple negative breast cancer (TNBC). However, BETi are plagued by a narrow therapeutic window as manifested by severe toxicities at effective doses. Therefore, it is a limitation
Zeynab Najafova et al.
Nucleic acids research, 45(1), 127-141 (2016-09-22)
Proper temporal epigenetic regulation of gene expression is essential for cell fate determination and tissue development. The Bromodomain-containing Protein-4 (BRD4) was previously shown to control the transcription of defined subsets of genes in various cell systems. In this study we
Han Guan et al.
Cancer medicine, 8(4), 1474-1485 (2019-02-21)
Prostate cancer is still considered a significant health care challenge worldwide due in part to the distinct transformation of androgen-dependent prostate cancer (ADPC) into treatment-refractory castration-resistant prostate cancer (CRPC). Consequently, there is an urgent need to explore novel molecular mechanisms
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico